Вязание спицами из кауни: Ошибка 404. Страница не найдена!

Содержание

Про кауни: ru_knitting — LiveJournal

Приветствую! Я решила не только мучить сообщество вопросами, но и причинить пользу:)
Изучила темы на осинке про кауни:
http://club.osinka.ru/topic-75545 и
http://club.osinka.ru/topic-66115
Сохранила себе отзывы, рекомендации и прочую нужную информацию, цитаты, в общем. Обобщила, делюсь. Много текста.

ПРО СЕКЦИИ

У Лавендера, Радуги и Лилак более короткие секции, чем у многих других цветов (примерно 50 метров, или 12-13 грамм на 1 цвет). (По другим данным, 75-80 метров)
А у других видов пряжи Артистик 8/2 один цвет занимает вдвое больший метраж ( по весу это 24-25 граммов на цвет вместе с переходом, или примерно 100 метров, т.к. пряжа 400 метров на 100 грамм).

Количество цветов равно четырем у Rusty, Grey-Orange, Fall. Радуга — 6 цветов. Green — 2 цвета. Все остальные по 3 цвета.

По-моему, любой цвет в длинной растяжке на узком шарфе должен хорошо получиться.
А если наоборот, надо получить короткие секции, то можно вязать из пряжи 8/1 от одного клубка в три сложения.
Делаю так: беру нитку от клубка и складываю ее вдвое. Придерживая одной рукой конец нити, в образовавшуюся петлю просовываю вторую руку и, захватив нить, протаскиваю ее в петлю настолько, насколько могу вытянуть руку. Получается как бы цепочка, вязаная крючком, только с очень длинными петлями, и вместо крючка действуете рукой. По-моему, это очень удобный способ — во-первых, не надо заранее перематывать всю шерсть, а нить складывается прямо в процессе вязания, а во-вторых, если случится распускать такую вещь, то нить сразу легко вытягивается в одну исходную из маленьких «тройных» кусочков.

А чтобы получились более короткие секции и уместились все цвета на шапке, можно вязать ее полой резинкой. Сразу получится очень теплая двойная шапка!

Нужно посмотреть мотки и выписать имеющиеся секции. Подряд вязать, возможно, не получиться, и, вероятно, мотки придется перемотать и выставить на клубках нужное начало секций. Зная, сколько секций у вас есть, можно решить, как их расположить. Если не получается полная симметрия по цветам, можно подобрать модель иного плана — в технике пэчворк, к примеру, или разбить детали изделия на вертикальные части, вариантов масса. Но вообще я уверена, что с такой длиной секции можно связать и вещь без заморочек, и всё будет по цвету симметрично, только нужно определиться, сколько у вас секций какого цвета и сделать парные клубки. А что будет непарное, пойдет на края изделий.

ПРО РАСХОД ПРЯЖИ И СПИЦЫ

Пряжа Aade Long довольно легкая, изделия из нее у меня лично получаются примерно в 1,5-2 раза легче, чем я привыкла использовать на подобные модели.

Пряжа 8/1 экономнее — примерно по 100 грамм на 1 шаль, а мини-шалька еще меньше
Из 8/2 тоже получаются замечательные шали.
Надо брать спицы №4.5-5.5, расход пряжи 8/2 на шаль примерно 200 граммов.

Для примера: я себе вязала ажурную кофточку (44-46 размера), ушло примерно 210 граммов. На простой свитер 44-46 размера надо грамм 300. Мужу на простой свитер на машине ушло 400 грамм (48 размер, лицевая гладь, недлинный, воротник под горло)
Ажуры, рыхлое вязание на более толстых спицах — уменьшают расход пряжи. Так что может и 300-400 граммов хватит.
Косы, плотная вязка, большой воротник — увеличивают, тогда нужно 500-600 граммов.

Свою тунику я вязала в одну нитку и на спицах №4. И мне в ней очень жарко. И думаю, хорошо что не взяла спицы тоньше. Ушло приблизительно граммов 250-270 на 48 размер.

8/1 будет хороша для кардигана крючком, №2-2,5 крючок вполне подходит, а полотно чуть плотнее получается, чем на спицах.

У меня из 8/2 связаны 2 больших палантина, расход по 1 пасме около 190-200 граммов. Моя мама связала треугольную шаль Revontuli из 8/2, расход примерно 150 граммов.

На шаль пошло 135г (плюс-минус 2 грамма), шаль средних размеров получилась — вполне завернуться можно. Пряжа 8/2, спицы №3.

Если вязать из пряжи толщиной 8/1 (800 м/100 грамм), то получится легкий и нежный, но очень теплый шарф (или шаль). И расход тонкой пряжи очень маленький: 70-80 грамм на небольшую шальку, 150 грамм — на очень большую.

А из 8/2 (400м на 100 г) получаются шикарные шали-шарфы-палантины. На улице их можно красиво накинуть на верхнюю одежду, а в помещении уютно закутаться или просто набросить на плечи.
Примерный расход на палантин или шаль — около 200 грамм.
На обычный шарф или на бактус хватит 100 грамм пряжи толщиной 8/2.

Я на свой европейский 34-36 рассчитываю что 1500 м-1700 м жаккардовой вязкой нужно.

Ниточка просто создана для крючковых вещей и думаю, что выигрышно будет смотреться в туниках, кардиганах, накидках, юбках. Хорошо держит форму после растяжки, рельеф рисунка смотрится отлично!

Юбку я не взвешивала, но, поскольку от 500 гр. остался немаленький клубочек, то рискну предположить, что граммов 350-400. Спицами №3.

Я, например, вяжу на спицах №2 и 400м/100гр и 250м/100гр

Радугу 8/2 я вяжу на спицах 3 мм

Смотря, насколько туго ты вяжешь. Лично по моим ощущениям — спицы 3 мм и больше для Кауни 8/2 хорошо, если только ты собираешься валять вещичку. Получается рыхленько и сваливается просто прекрасно.
Спицами 2 мм и 2,5 мм — очень даже хорошо получается просто для стирки в 30 градусах со спецсредствами для шерсти (т.е. чтобы не валять). Не садится, не растягивается.

Я вязала шаль из 8/2 на спицах №5.5 — получилось очень свободно, но для ажура на этой шали в самый раз.
Самые тонкие спицы, которые я брала для этой пряжи — это номер 2. Но лично у меня на них получается как-то туговато.
И еще могу сказать, что после стирки пряжа распушатся и ощущение «рыхлости» может поменяться.

Очень хорошо совмещают Кауни с мохером — будет архитеплая и легкая вещь.

ВАЛЯНИЕ

Сумка. Вязала ровницей в две нити на спицах №6, достаточно свободно. Дно сумочки вязала двойной резинкой. Валяла при температуре 60град, на режиме для белого. Мешок был очень большой и рыхлый. Ориентировочно усадка в длину 50%, в ширину 30%. Получился тааааакой валенок! Из оставшегося свяжу ручки, но валять, наверное, буду на 40 градусах.

Пришла к выводу, что для более ровного уваливания надо начинать с 40, потом доваливать на 60 (да, я хочу свалять настоящие валенки). А еще я последний раз слегка начесала — свалялось ровнее.

При 30 градусах на бережном режиме в моей машине не сваливается ни пряжа, ни даже ровница! Думала, что ровница всё-таки хоть чуточку сваляется. Оказалось — нисколечко! (стирала с «Лаской» для шерсти).
При 40 градусах на режиме «хлопок» с обычным стиральным порошком шапка из ровницы свалялась и усела очень сильно, еле-еле ее растянула до нормального размера. А пряжа 8/2 при 40 градусах чуть-чуть подвалялась и подсела примерно на 10%. Получилось очень мягкое, пушистенькое и приятное полотно.
При 60-ти градусах пряжа 8/2 валяется очень даже плотно, но по краям усадка получается поменьше. Для пробы розовая шапка связана прямо, без вывязывания расширяющихся «полей». После стирки края немного растянуты руками, чтобы придать форму.
Связано на машине 5 класса, плотность 10. В ширину — 170 петель, в высоту — около 130-140 рядов (от низа до макушки). 80 рядов — прямая вязка, потом помаленечку убавляла для формирования круглой макушки. Сзади – шов. Шов свалялся очень хорошо и был бы совсем незаметен, не поленись я сшивать его подходящими по цвету нитками. А у меня получилось, что розовая нить слишком видна на белом фоне.
Теперь попробую связать под «легкое» валяние беретку (при 40-ка градусах). Потому что плотно сваляная беретка показалась мне слишком толстой и неудобной в носке. А чуть-чуть подваляная должна быть в самый раз!

У меня есть не очень удачная «опытная» беретка. Она плохо усела при валянии в машине, так я ее доваляла вручную. Надела резиновые перчатки на теплые и комкала ее в очень горячей воде, даже без порошка.
Я ее именно комкала, сжимала, чтобы не было никаких «растягивающих» движений. В машине, когда барабан крутится, крупная вещь «размазывается» по кругу и растягивается в стороны центробежной силой. Чтобы этого не было, советуют отключать и отжим, и даже полоскание.

Я думаю, что может попробовать для валенок связать «носки» из ровницы в 3-4 нити на толстых спицах? Получится сразу толстенько и если еще уваляется плотно, то должно быть в самый раз

Я вязала по-разному. Самые удачные получились валенки из 3 нитей ровницы на 9 мм спицах, но двойные. При валянии все равно остаются дырочки, и при носке они становятся больше, а двойные компенсируют эти дырочки или просветы.
Еще очень важно подобрать модель для вязки, я пробовала сначала вязать как носки, но как ни провязывала пятку, все равно получались дырки, самое лучшее — вязать как пинетки, и много зависит от рисунка — лицевая гладь и платочная сваливаются по-разному, пришлось и это учитывать. Платочная садится намного сильнее и это может нарушить пропорции.

Для дома, думаю, достаточно лицевой глади, потому что платочная сваливается намного сильнее, гораздо плотнее изделие, но и расход пряжи тогда больше. В любом случае, свяжите образец и сваляйте, только так можно понять, что вам нужно. Форма после валяния, растягивания до нужного размера и высушивания сохраняется отлично, ничего дополнительного не нужно

Когда вяжешь для валяния, надо учитывать, что при более плотном вязании процент усадки меньше. Если вязать очень слабо, то усядет больше и полотно получится толще.

И еще раз хочу предупредить — даже самые маленькие дырочки при валянии расползаются, поэтому сразу обращайте на это внимание.

При валянии из пряжи получается усадка примерно 30% в ширину и 50% в высоту. Проще говоря, вяжите курточку вдвое длиннее, чем надо получить после усадки, и в полтора раза шире. Полотно получается приятное, напоминает плотненький драп. Оно вовсе не стоит колом, как валенок. Про растягивание краев прочитала, что их надо сразу после стирки стянуть ниткой и дать высохнуть в таком виде.
Еще можно отдельно связать-свалять небольшое полотно. Вырезать из него карманы и воротник, а потом их нашить на куртку.

Сарафанчик из Кауни 8/2, цвет Лавендер. Связано на 5 классе пл. 8. Сваляно — сначала стирка руками в шампуне, потом на «Синтетика 30» в жидкой ласке. Сушила наколотый по форме. Сел в длину около 20 см, в ширину- около 10. Распушился как мохер, очень легкий, теплый и совсем не колет. Вес — 500 гр.

Если ровницу валять — то нет, на одеяльце не пойдет. Полотно довольно жесткое получается. Больше не коврик похоже.
А вот просто из шерсти (если стирать на режиме шерсти, 30 градусов, со спецсредствами, чтоб не свалялось) — одеяльце очень даже ничего получится!

Я валяю сначала руками на пупырчатом коврике для душа, устраиваю жестокости с горячей водой и холодной, а потом в машинку на обычный режим с джинсами.
ИМХО — если свалялась хорошая вещь, надо ее беречь, не мучить больше, чтобы не было сюрпризов.

Я вкладываю внутрь сумки или рукавички обязательно что-то хлопковое, что трудно приваливается. Это может быть полотенце, старый носок — чтобы по размеру подходило для валяемой вещи. Валять изделие начинаю вручную, чтобы «запустился» процесс и чтобы удобнее было контролировать форму изделия. Когда появляются первые признаки сваливания, то кладу полотенце внутрь валяемой вещи и запускаю в машину. Стиральная машина в валянии не заменитель рукам, а только помощник и обязательно нужно контролировать и поправлять процесс — иногда начинает валяться неравномерно, заламываться, сгибаться — нужно остановить машину и расправить, подтянуть, набить заново тряпочки-полотенца.

Если после того, как Вы достали из машины изделие, вы уже высушили его, то вряд ли поможет последующая растяжка. Несколько см можно выиграть. Если достали из машины после валяния, то процесс еще не закончился — можно и нужно продолжать придавать форму изделию! Тянуть, фиксировать, усаживать — мокрая теплая шерсть работает как пластилин. Но вот когда «слепили»- нужно просушить до конца! Иначе может деформироваться.

Для процесса сваливания нужны: температура, щелочная среда ( моющее средство) и механическое воздействие. Если использовать только два условия, то чаще всего процесс уже начинает работать, но при одном — нет! Шерсть прекрасно переносит отпаривание, если узор при этом не требует другой обработки. После отпаривания нужно оставлять в зафиксированном виде до полного высыхания!

ЖАККАРДЫ

(Про знаменитый каунский жаккард :)) Дляя такого жаккарда используются обе ниточки одинаковой расцветки кауни, но смещают очередность цветов и вот так получается. Секции оттенков очень большие и дают такие акварельные размытые эффекты.

Для уверенности в расчетах надо брать жаккардовый рисунок, берущий одинаковое количество ниток как фона так и рисунка.
Тогда, если взять клубки, смотанные в одну сторону, то проблемы быть не должно. Например, представим абстрактную последовательность цветов — желтый, салатовый, светло-зеленый, зеленый, темно-зеленый, хаки — и сдвинем ее.
В случае же с рисунком, берущим отличное от фона количество ниток, на достаточно большом полотне совпадения в какой-то момент цветов избежать невозможно. На небольшом же вполне вероятно, что получится.

УХОД И СМЯГЧЕНИЕ

В последнюю воду для полоскания добавила кондиционер и половину пузырька глицерина (купила в аптеке) — вынула… меринос! Не колется вообще, растянулась ровненько.

Если в воду для полоскания добавить аптечный глицерин, дать полежать, а потом отжать — колоться будет намного меньше 🙂

Шерсть ополаскивают слабокислым раствором уксусной или лимонной кислоты для нейтрализации от щелочи. Шерсть становится мягкой, пушится, ворсинки не слипаются а распрямляются.

Нитки я стираю Дрефтом, а ополаскиваю в чуть теплой воде ополаскивателем московской фабрики Свобода, в тюбиках «Балет». Ни один кондиционер, ополаскиватель не борется так замечательно с жесткостью.

Попробовала постирать с глицерином. Ниточки мягче становятся, но осталась сторонницей использовать бальзам-ополаскиватель Балет (ф-ка Свобода).

Я делала следующим образом: набирала слегка тёплую воду в раковину — столько, чтобы вещь просто свободно лежала в воде, и добавляла столовую ложку глицерина (того, что в аптеке продаётся). Минут двадцать подержала, отжала — и всё! Запаха никакого у глицерина нет, поэтому не полоскала, использовала как последний этап. В общем, попробовала, и осталась довольна.

(НО)!
Я уже не раз писала, что шерсть не надо в ополаскиватель. Только в средство для шерсти с ланолином.

Положила на ночь мокрый образец в морозилку, и — ура! — вся колючесть исчезла!

Сделала тепловой шок. Что с ней стало!!!! Она же мягче ангоры стала!!!!! Как уж села пока не знаю. НО в морозилку точно положу — на балкон.
(Ответ) Ничего, подсохнет — вспомнит себя. К сожалению, алхимия свойств материалов не меняет, но лишнюю жесткость, появившуюся за счет фабричной обработки, стирка убрать может. Но в материалистических пределах. А то уж давно делали бы пряжу суперпупербэбисофт из самых колючих видов шерсти.

Эта шерсть хороша тем, что во влажно-теплом состоянии ее можно «лепить»- тянуть, усаживать, делать складки или их убирать.

Если после стирки разложить и наколоть вещь по размеру — она четко зафиксирует форму. Свитер с оленями я вязала, постирала и просто высушила — подсел…почти мал стал. Потом опять постирала и на пенопласте иголочками наколола — все так и осталось. Кауни при сушке четко форму схватывает и потом ее держит. Высушишь беретку на тарелке — будет все время как наутюженная.

Многоцветный конкурс. Модели из Кауни (Aade Lõng) . ПРИЗЫ!!!

Номинация — одежда


1.1. Осенняя акварель (Кардиган Dahlia от дизайнера Heather Zoppetti. Пряжа чистая шерсть Кауни 8/2 (400 м в 100 г), спицы 2,5.)

Осень, откуда в тебе притяжение?
Я ожидаю твой грустный сезон.
Тайно надеюсь впитать вдохновение
И постоять под летящим дождём.
Солнце не жгучее и не колючее
Трогает ласково плечи, лицо.
Грустно немного. Царит полнозвучие.
Катится жизни моей колесо….

на фотохостинг →

на фотохостинг →


1.2. Вешние воды (Юбка связана из пряжи Aade Lõng Artistic 8/2 «Aqua» (и жаккардовый рисунок, и фон) на спицах №3,5 снизу вверх по кругу без швов. Расход — 465 грамм)

Я так хочу весну! Она мне снится по ночам,
Она похожа на печаль и на веселье.
Я так хочу весну, чтобы себя умчать
Надежд ручьями в океан везенья.
Я буду плыть и плыть, и где-то синева небес
Окрасит мои воды весенним цветом.
Я буду плыть и плыть в тот океан чудес,
Который где-то есть у края света…

Вера Матвеева

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.3. La Que Sabe (Платье выполнено на спицах №3,5. Использована пряжа Aade Lõng Artistic 8/2 «Джинс» — 1100 грамм (юбка, рукава, капюшон) и Aade Lõng однотонная 8/2 «Джинс» — 100 грамм (лиф). Лиф связан по кругу, снизу вверх. Капюшон съемный. Рукава и капюшон вязаны от двух клубков со смещением цвета. Юбка состоит из 5 ярусов, связанных укороченными рядами и сшитыми вертикальным трикотажным швом.
Край капюшона и манжеты обвязаны крючком с использованием бисера Тохо. Вырез горловины обвязан крючком «рачьим шагом». На лифе — шнуровка, шнурок также втянут в низ рукавов и по краю капюшона.)

Семь ветров мне песни пели,
Семь девиц мне платье ткали,
Семь дорог — друг друга дальше —
Мне ковром под ноги пали.

Семь обличий я сменила.
Семь имён моих забыты.
Семь мужей, что я любила,
Во семи боях убиты.

Семь домов моих сгорели.
Пепел их развеял ветер.
Семь безумных скоморохов
Называли меня ведьмой.

Семиликая богиня,
Полуночная колдунья,
По семи своим дорогам
Семь веков уже иду я.

Иннельда (Тори)

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.4. Бабочки… (Пряжа Кауни Lilac 180г., семеновская Ольга 120г., спицы 2,0; 2,5; 2,75; 3,0; 3,5 мм. Связано по кругу. В пояс вдета широкая резинка. Узор с бабочками взят из журнала Верена, листики внизу — схема Jessica Tromp, цветочки на поясе — схема найдена на просторах интернета.)

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.5. Кардиган Аква (Кардиган Аква выполнен пряжи кауни 8/2 одноименного цвета, спицами № 3 и № 3, 5 круговые. Расход пряжи 400 гр.Оригинальная модель кардигана Dahila (георгин) с ажурной спинкой связана спицами единым полотном/ Модель кардигана из журнала Interweave Knits от дизайнера Heather Zoppetti (перевод с английского языка). )

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.6. Куртка Золотая Осень (Куртка связана из кауни Rusty 8/2, спицами № 3. За основу взята модель жакета Истинная леди. Жакет от Lutz & Patmos. )

Люблю я пышное природы увяданье,
В багрец и в золото одетые леса,
В их сенях ветра шум и свежее дыханье …

Александр Пушкин

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.7. В обнимку с радугой (Туника связана разносторонним вязанием из пряжи Кауни Радуга (400м/100гр) и твида серого цвета (420м/100гр). Из радужного прямоугольника в разные стороны вывязаны детали туники. Сшиты только плечевые скосы. Расход — около 150гр каждой из пряжи. Спицы 3.25.)

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.8. Комплект «Краски осени» (спицы 3.0, Кауни grey — orage, 450 гр вес комплекта, юбка из темы «Фейерверк красок — полосатая юбка спицами за два дня», шаль — «Lacy Katy» из темы «Вяжем мини шальки -шарфики (фишю/fichu). Легко и быстро.)

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.9. Интичурин (Intichurin — (кечуа) Сын Солнца…

Кардиган связан по заказу мужа. Пряжу и узоры он подбирал сам. А фасон и труд — мой. Так что это — совместный проект. Пряжа Aade Lõng Artistic 8/2 Rainbow и Black, Узоры взяты из книги Le Cont C.G. Andean Folk Knitting, Модель связана до пройм без швов в технике жаккарда поворотными рядами спицами 2.75 (протяжки на 1 — 2 петли). Отделка и манжеты рукавов – двусторонним жаккардом (спицы 1.75). Планки для молнии выполнены в технике ложной кетлёвки (спицы 1.75). Рукава ввязаны в пройму сверху вниз укороченными рядами. Вышивка центрального панно выполнена вручную только с лицевой стороны.)

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.10. Цветное время (Юбка выполнена машинной вязкой из пряжи Кauni Rainbow 8/2 (100 гр/400 м). На изделие ушло 250 гр пряжи. Авторская работа.)

Так улыбнись же! Улыбнись!
На задний план уйдут проблемы.
Возьми гуашь, альбом и кисть,
И нарисуй цветное время!

на фотохостинг →

на фотохостинг →


1.11. Генрих VIII на рыбалке (Воплощение модели HENRY VIII из книги «Tudor Roses» дизайнера Alice Starmore. Перевела Иририна. Спицы №3 и 2,5. Кауни Black и Blue II.)

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.12. Мои узоры (Юбка выполнена спицами с использованием Кауни brown-black 8/2 и Ализе кашмира. Юбка клешеная за счет увеличения петель в однотонных полосах. Внизу вывязаны две бордовые оборки. Очень люблю эту юбку, считаю одной из любимейших моделей. Прохожие обращают на нее внимание.)

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.13. Лисьи лапки (Юбка связана спицами 4 мм. Пряжа: основная — Кауни Радуга 8/2, дополнительная — «TURN Гарус» черная и белая в 2 сложения. Узор «Fox Paws» by Xandy Peters)

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.14. Обережная юбочка Водь (Юбочка связана спицами №3 и руками в технике жаккардового вязания из пряжи Кауни Red 2+ однотонный черный. 100% шерсть — теплая и уникальная. Вдохновила меня на эту самый наверное сложный жаккардовый узор меня Ольга из этнографического музея в Питере. Юбочка связана по обережным узорам древней северной народности Водь и в ней отображена вся жизнь на земле как еепредставляли раньше. Сверху птицы, потом птицы с людьми, люди, люди с животным миром, каждый узор имеет глубокое сакральное значение, а переходы цвета подчеркивают узоры. Само сочетание красных тонов и черного тоже не случайно. Благодарю за возможность участвовать в конкурсе!)

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.15. Юбочка «Осеннее волшебство» (Жаккардовая юбочка «Осеннее волшебство» связана спицами №3 из пряжи Кауни grey-orange 8/2 + белый барашковый:) длина юбочка 80 см. Она для меня самая осенняя из моих юбок. Вяжу я их уже около трех лет, как связала для себя, вдохновившись на осинке, так и вяжу теперь, причем с удовольствием и любовью, для знакомых и незнакомых девочек))) Для меня это творчество, которое несет заряд любви и счастья! А еще красоту в серые зимние дни. Ведь это был большой вопрос для меня раньше как одеться зимой и тепло и красиво и женственно:) Надеюсь получилось) Всем удачи в конкурсе и спасибо за возможность участвовать!)

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.16. Платье » В ожидании мира» (Платье связано без швов, реглан сверху, вывязанные вытачки. Спицы № 2,5 и 3, пряжа однотонная Light grey и Brown-pink 8/2. Схемы найдены в интернете и переделаны под нужный размер.)

Михаил Крюков «Стихи о родном доме»

Гостить в чужих краях доводится порою —
Там по родному дому я грущу, не скрою,
И с каждым днём всё с бОльшим нетерпеньем жду,
Когда в места родные снова я приду.

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.17. Жаккардовый костюм «Крокусы на снегу» (Этот жаккардовый костюмчик связан спицами №3 для прекрасной девушки Оксаны из пряжи Кауни Lavander 8/2 и сиреневого беби-вул. Всего ушло около 800 г пряжи, длина юбки 75 см. Костюм случился не сразу, началось все с юбочки как обычно, а потом и жилетик напросился связаться:) Лавандер сам по себе очень женский и красивый цвет, уникальный его ни с чем не спутать. Благодарю Вас, девочки! За вдохновение и радость, что вы мне дарите!)

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.18. Закат в лесу (Пряжа Кауни (Aade Lõng) 8\1, цвет из ограниченной коллекции. Крючки 1,5, 1,75 и 2 мм. За основу взята идея джемпера из Дома моделей.)

Игорь Казанский
Закат в лесу

Закат был розово-сиренев/ Над изумрудом хвойных грив./ Он сладким сном стволы деревьев/ Окутал, ночь предотворив.
Могучим соснам корабельным/ Он колыбельную шептал,/ И, вняв заката колыбельной,/ Лес зачарованно дремал.
Пахучие лесные травы/ Заснули, пней касаясь плах./ Стекавшая янтарной лавой/ Смола заснула на стволах.
В лесной глуши заворожённый/ Ручей уснул глубок и чист./ В его воде отображённый/ Светился неба аметист.

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.19 Радужный кардиган (Кауни радуга 8/2, около 250 гр. и темно-красная 100% шерсть, около 150 гр. Спицы №4 (тело) и 3.5 (планки). Источник идеи — Осинка. )

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.20 Березовая роща (Кауни 8/2 black-white фон и Teksrena красно-черная жаккард, вес платья 450г, спицы 2,5)

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.21. Южная ночь (blue-violet 8/2 (8/1-окантовка и цветы),спицы,крючок.)

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.22. Повитруля (Трансформер. Пряжа Кауни 8/2 многоцветная и однотонная. Машинное вязание, укороченные ряды, крючок — ленточное кружево. Вдохновение нашла на просторах интернета.)

Повитруля — национальный украинский мифологический положительный персонаж женского пола. Ассоциируется со стихией ветра (дочь горных ветров) — легкая, способна передвигаться в воздухе, не касаясь земли.

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.23 Осенний бор (Пальто связано крючком из пряжи Aade Lõng 8/2 в три сложения, крючком № 6. Основной цвет Light Lila, рукава, воротник и карман — Lavander I. Идею позаимствовала у Tancha http://club.osinka.ru/topic-43426?p=7442109#7442109 .
Чтобы переходы цветов были более выраженными, нитки артистик вязала в три сложения от одного клубка. Пуговицы самодельные, из Lavander I.)

Поджарые сосны и тощий вереск,
и тонкие иглы в сухом песке.
И сучья скрипят, словно старые двери.
И лето висит на одном волоске.
Н. В. Димчевский

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.24. Юбка «Репейник» (Спицы №2,5, пряжа для фона Кауни Lamb, 250г, для жаккарда- пряжа ZEGNA BARUFFA BABA 1500м/100г, 70% меринос экстрафайн 30% кашемир, цвет вишня-бордо и ADELIA Claire – все вместе 200г. Вдохновением послужил плед Flowers of Scotland by Ruth Sorensen. Жаккард без протяжек.)

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.25. Пальто на подкладе (Спицы 3.0, Кауни Aade Long Artistic 8/2 Pink-lila, подклад -шелк. Вес изделия без подклада — 530 гр. Источником вдохновения послужила работа участницы сайта Лены Гусик@ http://club.osinka.ru/topic-158546?p=14592620#14592620)

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.26. Осенние сумерки (Работа выполнена из пряжи Кауни Томас 8/2, в 1 нить, абрикосовая секция заменена на белую, для неё использовалась итальянская стоковая пряжа с ангорой. Спицы № 6, для резинки № 5,5. Ушло пряжи меньше 1 пасмы, готовое изделие весит 202 грамма.)

на фотохостинг →

на фотохостинг →

на фотохостинг →


1.27. Небо, осень и земля (Пальто пряжа Кауни 8/2 в 2 сложения, браун-блю 600г в технике жаккарда, спицы 3,5. Для жаккарда использованы мохер и фантазийная пряжа.)

Вдохновением для создания данной модели послужили осень и песня певицы Земфиры

на фотохостинг →

на фотохостинг →

на фотохостинг →

на фотохостинг →

Пряжа Кауни ART 8/2 Pink-Lila (розово-лиловый) Artistic 8/2 (цветная)

Пряжа подходит для ручной и машинной вязки. 100% овечья шерсть. В 100 г примерно 400 метров. Секции каждого цветового перехода длинные, поэтому пряжа идеальна для вязания больших вещей — кардиганов, пончо, свитеров и т.д.) Пряжа поставляется в пасмах, каждая имеет свой индивидуальный вес 150-300 г. Стоимость пряжи указана за 100 г. Пряжа Aade Long довольно легкая, изделия из нее получаются примерно в 1,5-2 раза легче, чем мы привыкли использовать на подобные модели. Пряжа 8/1 экономнее — примерно по 100 грамм на 1 шаль, а мини-шалька еще меньше Из 8/2 тоже получаются замечательные шали. Надо брать спицы №4.5-5.5, расход пряжи 8/2 на шаль примерно 200 граммов. Для примера: я себе вязала ажурную кофточку (44-46 размера), ушло примерно 210 граммов. На простой свитер 44-46 размера надо грамм 300. Мужу на простой свитер на машине ушло 400 грамм (48 размер, лицевая гладь, недлинный, воротник под горло) Ажуры, рыхлое вязание на более толстых спицах — уменьшают расход пряжи. Так что может и 300-400 граммов хватит. Косы, плотная вязка, большой воротник — увеличивают, тогда нужно 500-600 граммов. Свою тунику я вязала в одну нитку и на спицах №4. И мне в ней очень жарко. Ушло приблизительно граммов 250-270 на 48 размер. 8/1 будет хороша для кардигана крючком, №2-2,5 крючок вполне подходит, а полотно чуть плотнее получается, чем на спицах. У меня из 8/2 связаны 2 больших палантина, расход по 1 пасме около 190-200 граммов. На треугольную шаль Revontuli из 8/2, расход примерно 150 граммов. На шаль пошло 135г (плюс-минус 2 грамма), шаль средних размеров получилась — вполне завернуться можно. Пряжа 8/2, спицы №3. Если вязать из пряжи толщиной 8/1 (800 м/100 грамм), то получится легкий и нежный, но очень теплый шарф (или шаль). И расход тонкой пряжи очень маленький: 70-80 грамм на небольшую шальку, 150 грамм — на очень большую. А из 8/2 (400м на 100 г) получаются шикарные шали-шарфы-палантины. На улице их можно красиво накинуть на верхнюю одежду, а в помещении уютно закутаться или просто набросить на плечи. Примерный расход на палантин или шаль — около 200 грамм. На обычный шарф или на бактус хватит 100 грамм пряжи толщиной 8/2.

ПОЛЕЗНО ЗНАТЬ

Расход пряжи:

Пряжа Кауни легче, чем подобная 100% шерстяная пряжа. За счет этого, расход на изделие получается меньше, что не может не радовать мастериц. Пример: джемпер 44 р с косами, воротником требует, как правило, 700-800г пряжи. Если вяжете из Кауни 8/2, то Вам понадобится не более 600г, а то и 500г будет достаточно. Пряжа очень теплая, поэтому зимние вещи можно и в одну нитку вязать  — не замерзнете. Спицами №3 можно связать шикарную юбку из 400г, а если шаль вязать, то 150г будет достаточно. 

   Из пряжи 8/1 получаются замечательные ажурные шали, палантины. Расход примерно 100г. Хорошо вязать пряжу 8/1крючком – тогда полотно будет чуть плотнее, чем на спицах. На тунику 48 размера уходит примерно 250-300г.

   А можно совместить Кауни с мохером и можно на мороз без шубы идти (шутка) – получаются сверх-легкие и теплые вещи. Попробуйте обязательно.

   Если нужно соединить нить при подборе цветов – смело рвите нить, а потом сваляйте концы (мокрыми руками покатать нить между ладоней или пальцев). Узелков делать не надо. Эта нить после стирки станет пушистой и не разойдется в месте скрепления.

Уход за пряжей:

   Если вы решили связать вещь из Кауни – настоятельно рекомендуем постирать пряжу до начала творения шедевра. Пряжа продается в пасмах, а значит, для стирки не требуется перемотка. Перевяжите пасму не туго в 4х местах. 

   Налейте чуть теплой воды в таз, добавьте средство для мытья посуды и осторожно помните нитки. Грязную воду слейте.Опять налейте чуть теплой воды, добавьте шампунь для волос без бальзама и повторите процедуру стирки. Третий раз в воду добавьте средство для стирки шерстяных изделий. 

   Прополоскайте в воде такой же температуры, как и стирали, только с добавлением бальзама для волос (кто-то добавляет обычный аптечный глицерин). Отожмите в машинке на 800 оборотов. 

   Разложите вдалеке от отопительных приборов и на ровной поверхности (чтобы не было заломов). Вязаные вещи из Кауни рекомендуется при сушке блокировать, чтобы придавать нужную форму.

   Полезные ссылки: 

   В интернете есть много полезных мест, о которых многие не знают (мы, например). Поэтому спешим поделиться тем, что знаем. 

   www.ravelry.com – сайт, где люди со всего мира выставляют свои вязаные шедевры с описаниями. Некоторые платные, а некоторые в свободном доступе. Там можно «бродить» до бесконечности и вдохновляться, и вдохновляться….

   www.knits4kids.com – сайт, где собрана богатейшая библиотека журналов и книг по вязанию со всего мира. Не надо ничего скачивать, просто бери, читай и твори. Удивительный сайт! 

Схемоследилка для вязальщиц. О-о-очень полезная вещь!!!!

Скачать программу можно здесь:

 http://xinki.ru/doku.php/soft/chartilka

   Если вы знаете еще места, куда надо заглянуть обязательно, то присылайте нам – мы поделимся со всеми.

 

 

 

Покупаем стильную пряжу Кауни для вязания


Читали: 2837


Версия для печати


Если вы нашли ошибку в тексте — выделите ее и нажмите CTR+Enter

Кто не мечтает получить в подарок теплый мягкий свитер, связанный любящими руками? Вязание спицами или крючком — достойное хобби для молодых хозяек. Оно переходит из поколения в поколение по женской линии. Книжные магазины пестрят современными изданиями по технике вязания. Интернет-ресурсы предлагают схемы рисунков, рассказывают о правильном сочетании нитей, предоставляют размеры мужской, женской и детской одежды. Для вязания теплых свитеров, шарфов, варежек подходит фирменная Пряжа Кауни. В ее составе только овечья шерсть, окрашенная натуральными немецкими красками. Родина пряжи — Эстония. Натуральный состав нити позволяет удерживать тепло и обладает хорошей вентиляцией. В носке вещи не перетягиваются, долгое время сохраняют первоначальную форму и яркость цвета.

Отдельно нужно отметить линейку Артистик. Красивое секционное окрашивание позволяет воплотить много творческих проектов. Гармоничный перелив цвета обращает на себя внимание при носке готового изделия. Любые одинаковые вещи, связанные из таких нитей, благодаря разной плотности вязания смотрятся по-разному. Кажется, что были использованы нити другого фасона. Такое впечатление создается благодаря разной длине каждого цвета. При желании можно подобрать плавный переход оттенков одного цвета. Структура нити выполнена таким образом, что даже начинающие рукодельницы смогут справиться с ней. Особенно хорошо смотрится крупная вязка в стиле кантри. Нить хорошо смотрится на гетрах, палантинах, шалях, платьях.

Тонкие вещи и отделка вяжутся ниткой в одно сложение. Объемные вещи лучше смотрятся из нити в два сложения. Комбинирование вязки нитей разной толщины в одном изделии позволит вещи смотреться более стильно. Выбор пряжи есть на сайте http://www.vseoleni.ru/category/prjazha-dlja-vjazanija/ или в магазине около станции метро «Белорусская». На сайте расположен каталог работ из пряжи Кауни, выполненных местными мастерицами. Пряжа смотана по 200 г. Поэтому при покупке стоит учитывать цену, указанную за 100 г пряжи. Остальную информацию можно прочитать в разделах сайта «Прайс-лист», «Контакты» и «Обратная связь».











Последние новости







Радуга цветов кауни и дундаги | ВЯЗАНИЕ СПИЦАМИ И КРЮЧКОМ

https://cs5.livemaster.ru/storage/7d/a6/568af96c51ce2aa8b13a34d630is—aksessuary-pryazha-kauni-sherst-dlya-vyazaniya.jpg

https://cs5.livemaster.ru/storage/7d/a6/568af96c51ce2aa8b13a34d630is—aksessuary-pryazha-kauni-sherst-dlya-vyazaniya.jpg

Уже конец ноября, настало время холодов. Впереди долгая и морозная зима. Обожаю снежную зиму! И с огромным удовольствием вяжу разнообразные шерстяные вещи!

Любители вязания приобретают шерстяную пряжу для изготовления тёплых изделий любимым и близким людям. Многие рукодельницы предпочитает вязать из чистошерстяной пряжи. Я не исключение, честно говоря. Долгие годы моей любимой пряжей была и есть верблюжья. Теплая, легкая и лечебная! Это основные привлекательные свойства верблюжьей пряжи. В интернете уже долгие годы присматриваюсь и к другим видам пряжи. Например, к кауни и дундаге.

Кауни и дундага отличаются от верблюжьей, прежде всего, качеством и расцветкой. Сочные, яркие, красивые цвета! Такие расцветки называют — «вкусными»!

В интернете познакомилась с замечательными и эксклюзивными КАУНИ и ДУНДАГОЙ. Это чистошерстяная пряжа (100 % шерсти), продаётся в основном, в пасмах. У всех пасм вес разный. Пряжа бывает в два сложения или в одну ниточку. Из кауни и дундаги можно связать всё!

Кауни и дундагу называют ещё эксклюзивной и незабываемой пряжей.

На просторах интернета я восхищалась разнообразными вязаными изделиями из кауни и дундаги: шали, шапки, шарфы, варежки, кардиганы, платья, пуловеры, юбки. Возможно, в крупных городах есть магазины, в которых можно их приобрести. Я нашла только интернет магазины и индивидуальных продавцов, торгующих этой пряжей.

Эта шаль связана из пряжи ДУНДАГА:

https://st.stranamam.ru/data/cache/2016jan/29/05/18482187_91554nothumb650.jpg

https://st.stranamam.ru/data/cache/2016jan/29/05/18482187_91554nothumb650.jpg

Дундага — замечательная латвийская пряжа, производится из шерсти овец местных пород. Удивительную пряжу кауни изготавливают из эстонской и новозеландской шерсти. Кауни и дундага может быть однотонной и секционной, можно вязать крючком, спицами, на вязальной машине. Интересные цветовые переходы: длинные, модные и красивые, мягкие оттенки .

А эта шаль связана из КАУНИ:

https://st.stranamam.ru/data/cache/2016nov/04/44/20953002_92506thumb500.jpg

https://st.stranamam.ru/data/cache/2016nov/04/44/20953002_92506thumb500.jpg

Когда то я увлекалась вязанием разнообразных шалей, в основном из верблюжьей пряжи. Поэтому подобрала именно шали в написании этой статьи. На сайте «Страна мам»много чудесных моделей, любовалась разнообразными моделями и любезно взяла две фотографии.

Конечно, у этой пряжи есть достоинства и недостатки.

Почему я до сих пор не приобрела эту замечательную пряжу? Прежде всего, потому что о ней многие вязальщицы отзываются как об очень колючей. И ещё есть важный нюанс — пряжа с большим количеством мусора. Хотя, я тоже покупала верблюжью пряжу в пасмах, стирала, сушила и перематывала в клубочки. А потом только вязала шали. Но мусор в верблюжьей пряже не встречала.

В моих планах связать разноцветный джемпер или тунику с разноцветными переходами, из 100 % шерсти. теплую вещь, красивую, нарядную. И конечно же, мечтаю связать шаль! Шали — это моя слабость. Но читала отзывы в интернете, что овечья пряжа колючая. Комфортно ли мне будет носить изделия из кауни и дундаги?

Дорогие подписчики и читатели канала! Поделитесь вашим опытом и мнением по этому вопросу. Возможно, вы покупали пряжу кауни и дундагу, вязали вещи и носили их. Очень ли колючая эта пряжа? Понимаю, что пряжа чистошерстяная, после стирки может давать усадку в изделиях. Ваше мнение для меня очень важно.

ЖМИТЕ ЛАЙК!

Подписывайтесь на канал!

ВАША

ВЯЗАНИЕ СПИЦАМИ И КРЮЧКОМ

ПРЯЖА КАУНИ. ЧТО ЭТО? 1. Что… — Вязание, схемы и описания

ПРЯЖА КАУНИ. ЧТО ЭТО?

1. Что такое пряжа Кауни? Дундага, Wool&Yarn и другая пряжа из Прибалтики – это тоже Кауни?

Kauni – это датская торговая марка и одноименная компания, которая закупает пряжу на нескольких прибалтийских фабриках, стирает и расфасовывает ее в стандартные мотки, после чего продает в Дании и по всему миру. Именно под маркой Kauni чистошерстяная длинносекционная пряжа стала знаменита среди вязальщиц. Так как большую часть пряжи для Kauni поставляет именно фабрика Aade Long, на который мы с вами и закупаемся, то можно поставить условный знак равенства между названием Кауни, которое у всех на слуху, и нитками, которые делает Aade Long. Можно ли называть шерсть с латвийской фабрики Дундага и эстонской Wool&Yarn – Кауни? Строго говоря, нет.
На практике же в русскоязычном вязальном интернете словом Кауни частенько называют всю прибалтийскую секционку.

Кстати, само слово kauni по-эстонски значит «красивый».

2. Почему Кауни так мало и она не продается в обычных магазинах? Почему иногда предзаказанная пряжа не приходит?

Фабрика Aade Long – маленькое частное предприятие, где трудится, в зависимости от сезона, всего 12-15 человек. Из них часть занята административной работой и продажами, так что на долю производства остается всего десяток работников. Прядильных машин – две, они стоят там еще с 70-х годов. Фабрика чисто физически не может сделать столько пряжи, чтобы удовлетворить спрос хотя бы даже одного Санкт-Петербурга, не говоря уже обо всей России. К тому же, заказчиком с приоритетом №1 для них всегда является датская Kauni. Потребности Kauni, большей частью, и определяют стратегию производства – какие расцветки будут делаться в текущем месяце. Есть ряд расцветок, которые делают часто – например, знаковая для фабрики Artistic Rainbow (она есть на складе абсолютно всегда), а есть те, что «заряжают» в машины раз в несколько месяцев – например, Artistic Denim или Artistic Green. К тому же, спрос на пряжу Aade Long огромный, и в сезон (оcень-зима) склад просто разметают. Поэтому предзаказанной шерсти иногда приходится ждать 2-3 месяца.

3. Что такое пасма?

Пасма – это моток, сложенный и перекрученный в несколько раз для удобства хранения и перевозки. Пасму нужно перемотать в клубок, так как вязать непосредственно от нее неудобно. Для этого можно воспользоваться любой моталкой – старой советской или современной, а также спинкой стула или руками близких.

4. Как на готовом изделии получаются цветовые полосы? Нужно ли что-то специально для этого делать или все само получается? (Это типичный вопрос от человека, который из Кауни не вязал еще ни разу).

Ответ – нет, ничего делать не надо, цвет нити плавно переходит от одной секции к другой, создавая красивый градиент. Вам требуется просто вязать, а все остальное нитка сделает за вас.

5. Секции Кауни получаются путем окрашивания в разные цвета?

Нет, для создания цветовых переходов берутся пласты кардочеса разного цвета и накладываются друг на друга со смещением. То есть, нить прядется из сырья разных цветов, а не окрашивается.

6. Какая длина секций у Кауни? Одинакова ли длина секций в разных пасмах?

Длина секция у разных расцветок разная. Самые короткие секции у Artistic Rainbow, в нее входит 6 цветов, самые длинные, например, у Artistic Lavender (3 цвета) – от 30-35 м до 100 м. В целом, чем меньше секций у данной расцветки, тем они длиннее. В разных пасмах одной и той же расцветки секции должны иметь одинаковую длину.

7. Почему пасмы выглядят по-разному?
Действительно, пасмы одной и той же расцветки могут выглядеть немного по-разному, снаружи мотка может оказаться та или другая цветовая секция. Это зависит только от того, как легла нить при намотке и на какой секции закончился данный конкретный моток. В любом случае, внутри каждая из пасм «устроена» одинаково – секции в ней тех же цветов и той же длины, как и у соседней пасмы аналогичной расцветки.

8. Что такое ровница и что из нее вяжут?

Ровница – это непряденная шерсть, разделенная на тонкие или толстые пряди. Ровница очень мягкая и хорошо сваливается при валянии. Изделия из ровницы оптимально хотя бы немного подваливать после вязания. Ровницу вяжут и крючком, и на спицах. Из нее хорошо получаются береты, теплые пальто сумки, коврики.

9. Надо ли стирать пасмы перед вязанием?

Нет однозначного ответа на этот вопрос. Кому-то больше нравится постиранная пряжа – она более пушистая, мягкая, яркая, а кому-то по нраву процесс преображения готовой шали после стирки. В целом, принципиального значения вопрос стирки не имеет. Имеет смысл постирать образец, если размеры готового изделия критичны (свитер и т.п.)

10. Из чего делают Кауни? Колется ли она в носке, есть ли специфический запах?

Пряжу Aade long делают из чистошерстяного кардочеса, поставляемого из Новой Зеландии и Германии. Эстонское сырье на данный момент не используется ввиду недостаточно высокого качества. Тем, кто привык к обработке super wash, Кауни может показаться немного колючей. Из нее вряд ли стоит вязать вещи, которые будут носиться на голое тело. Впрочем, много зависит от индивидуальной чувствительности. При стирке пасм можно добавлять специальные средства для смягчения шерсти, кондиционер для волос или чистый глицерин – это поможет смягчить пряжу. Что же касается запаха, то натуральная шерсть с минимальной обработкой НЕ пахнуть не может и не должна, но этот запах, скорее, приятный.
Один из способов стирки Кауни можно подсмотреть вот здесь: http://vk.com/nitki_kauni?w=wall-58678379_42/all

11. Что такое 8/1, 8/2 и 8/3?

Это обозначение толщины пряжи. Первая цифра дроби показывает метраж первичной нити в одном грамме пряжи, вторая – количество сложений. Таким образом,
8/1 значит «800 метров в одно сложение», то есть 800 м на 100 г,
8/2 значит «800 метров в два сложения», то есть 400 м на 100 г,
8/3 значит «800 м в три сложения», то есть 267 м на 100 г.

Приятного вам вязания!

(с) Анастасия Ставрович
http://www.liveinternet.ru/users/4669494/post337511479/

Роман: Фут, Шелби: 9780679736165: Amazon.com: Книги

«Писания мистера Фута удивительно точны и позитивны. Его отношение к своему народу — уважительное и человечное, как если бы он думал о них очень ловко и слишком много знал о них, чтобы принимать их как должное».

и Фут взял свою эпическую историю Гражданской войны, он написал эту вымышленную хронику — «пейзаж в повествовании» — графства Джордан, штат Миссисипи, места, где травмы рабства, войны и восстановления столь же ощутимы, как камень. образования.Семь историй в графстве Джордан перемещаются в прошлое, с 1950 по 1797 год, и через жизни персонажей столь же разнообразных, как игрок на черных рожках, обреченный туберкулезом и конвульсивной ревностью, измученный и беспомощный аристократ конца века и полтора -дикий пограничник, который строит плантацию на территории чокто только для того, чтобы наблюдать, как она горит в конце Гражданской войны. В прозе почти библейской серьезности; и с глубоким знанием того, как история формирует человеческие жизни — а иногда и искажает их без возможности восстановления — Фут дает нам амбициозное, тревожное произведение художественной литературы, основанное на традициях Уильяма Фолкнера и Фланнери О’Коннор, но это решительно уникальный.

С задней стороны обложки

Прежде чем Шелби Фут начал свою эпическую историю Гражданской войны, он написал эту вымышленную хронику — «пейзаж в повествовании» — графства Джордан, штат Миссисипи, места, где травмы рабства, войны и восстановления столь же ощутимы, как и скальные образования. Семь историй в графстве Джордан перемещаются в прошлое, с 1950 по 1797 год, и через жизни персонажей столь же разнообразных, как игрок на черных рожках, обреченный туберкулезом и конвульсивной ревностью, измученный и беспомощный аристократ конца века и полтора -дикий пограничник, который строит плантацию на территории чокто только для того, чтобы наблюдать, как она горит в конце Гражданской войны.В прозе почти библейской серьезности; и с глубоким знанием того, как история формирует человеческие жизни — а иногда и искажает их без возможности восстановления — Фут дает нам амбициозное, тревожное произведение художественной литературы, основанное на традициях Уильяма Фолкнера и Фланнери О’Коннор, но это решительно уникальный.

Об авторе

Шелби Фут родился 7 ноября 1916 года в Гринвилле, штат Миссисипи, и посещал там школу, пока не поступил в Университет Северной Каролины.Во время Второй мировой войны он служил капитаном полевой артиллерии, но никогда не участвовал в боях. После Второй мировой войны он некоторое время работал в агентстве Ассошиэйтед Пресс в их нью-йоркском бюро. В 1953 году он переехал в Мемфис, где прожил остаток своей жизни. Фут был автором шести романов: Tournament , Follow Me Down , Love in a Dry Season , Shiloh , Jordan County. и сентябрь, сентябрь г. Его лучше всего помнят за его трехтомную историю « Гражданская война: повествование », на завершение которой потребовалось двадцать лет, в результате чего он стал признанным экспертом в знаменитом документальном фильме Кена Бернса о Гражданской войне.За свою писательскую карьеру Фут также был удостоен трех стипендий Гуггенхайма. Шелби Фут умер в 2005 году в возрасте 88 лет.

Широкий геном с высоким разрешением у Candida spp. Использование ChEC-seq

РЕФЕРАТ

Чтобы сохраняться в своей динамической среде хозяина, грибковые патогены должны ощущать и адаптироваться, модулируя экспрессию своих генов для удовлетворения своих клеточных потребностей. Понимание регуляции транскрипции в глобальном масштабе позволит раскрыть клеточные процессы, связанные с механизмами устойчивости и вирулентности, которые могут быть нацелены на противогрибковую терапию.Инфекции, связанные с дрожжевым грибком Candida albicans , широко распространенным грибковым патогеном, и родственным ему видом Candida auris с множественной устойчивостью, становятся серьезной угрозой общественному здоровью. Для определения набора гена, регулируемого регулятором транскрипции в C. albicans , используются методы на основе иммунопреципитации хроматина (ChIP), включая ChIP с технологией микрочипа (ChIP-chip) или ChIP-ДНК-секвенирование (ChIP-seq). широко использовались. Здесь мы описываем новый набор плазмид, помечающих микрококковую нуклеазу (MNase) на основе ПЦР для C.albicans и другие Candida spp. для определения местоположения любого интересующего регулятора транскрипции по всему геному с помощью эндогенного расщепления хроматина (ChEC) в сочетании с высокопроизводительным секвенированием (ChEC-seq). Процедура ChEC не требует сшивания белок-ДНК или обработки ультразвуком, что позволяет избежать артефактов, связанных с маскированием эпитопа или феноменом гипер-ChIPable euchromatic. В качестве доказательства концепции применения ChEC-seq мы предоставили карту связывания с высоким разрешением комплекса ремоделирования хроматина SWI / SNF, главного регулятора приспособленности грибов в C.albicans , в дополнение к фактору транскрипции Nsi1, который является ортологом ДНК-связывающего белка Reb1, для которого полногеномная занятость была ранее установлена ​​в Saccharomyces cerevisiae . Описанная здесь процедура ChEC-seq позволит определить геномное местоположение с высоким разрешением, что позволит лучше понять схемы регуляции транскрипции, которые регулируют приспособленность грибов и устойчивость к лекарствам у этих важных с медицинской точки зрения грибов.

ВАЖНОСТЬ Системные грибковые инфекции, вызываемые Candida albicans и «супербактериями» Candida auris , становятся серьезной угрозой общественному здоровью.Способность этих дрожжей вызывать болезнь связана с их способностью модулировать экспрессию генов, которые опосредуют их уход от иммунного надзора и их устойчивость в различных неблагоприятных нишах внутри хозяина. Всесторонние знания о контроле экспрессии генов и приспособленности грибов, следовательно, представляют собой интересную основу для идентификации основных инфекционных процессов, которым могут препятствовать химические вещества в качестве потенциальных терапевтических средств. Здесь мы расширили использование ChEC-seq, техники, которая была первоначально разработана в дрожжевой модели Saccharomyces cerevisiae для идентификации генов, которые модулируются регулятором транскрипции, в патогенных дрожжах из рода Candida .Этот надежный метод позволит лучше охарактеризовать ключевые регуляторы экспрессии генов и их вклад в вирулентность и противогрибковую устойчивость этих патогенных дрожжей.

КЛЮЧЕВЫЕ СЛОВА: Candida albicans , Candida spp., ChEC-seq, полногеномная занятость, транскрипционная регуляторная сеть

ВВЕДЕНИЕ

Виды Candida , в частности Candida albicans , являются основными компонентами бремя болезней, вызываемых грибками, которые часто являются причиной опасных для жизни инвазивных инфекций, особенно у пациентов с ослабленным иммунитетом.Эмерджентный Candida auris был первым грибковым патогеном, который считался неотложной угрозой общественному здоровью из-за его множественной лекарственной устойчивости, высокой передачи среди пациентов в медицинских учреждениях и повышенной общей смертности (1). Другие виды Candida , такие как C. parapsilosis , C. tropicalis , C. guilliermondii и азолустойчивые дрожжи C. glabrata и C. krusei , также являются частыми причинами кандидоза и вульвовагинита. инфекции (2, –4).Современные терапевтические средства против Candida страдают различными ограничениями, включая токсичность, резистентность и взаимодействие с другими обычно назначаемыми лекарствами. Это привело к росту интереса к изучению механизмов, лежащих в основе устойчивости и вирулентности видов Candida , с конечной целью определить потенциальные мишени для лекарств для нового противогрибкового терапевтического вмешательства. Однако диплоидная природа и отсутствие полного полового цикла у большинства видов Candida ограничивают использование классических генетических подходов для анализа механизмов, контролирующих приспособленность грибов и устойчивость к противогрибковым препаратам.В качестве альтернативы, применение полногеномных методов транскрипции, таких как определение изменений экспрессии генов (ДНК-микрочипы и секвенирование транскриптома [RNA-seq]) или геномной занятости (иммунопреципитация хроматина с помощью технологии микроматриц [ChIP-chip] и иммунопреципитация хроматина-ДНК [ChIP- seq]) у видов Candida внес значительный вклад в раскрытие различных аспектов биологии грибов, которые имеют решающее значение как для условно-патогенного, так и для комменсального образа жизни, в дополнение к противогрибковой толерантности и устойчивости (5, –17).Эти подходы также помогли раскрыть удивительную степень эволюционной пластичности схем регуляции транскрипции у этих видов по сравнению с модельными дрожжами Saccharomyces cerevisiae (18, 19).

В то время как ChIP-chip и ChIP-seq традиционно использовались для объективного картирования связывания регулятора транскрипции (TR), этот инструмент имеет некоторые ограничения, которые в основном приписываются сшиванию TR-ДНК и срезанию ДНК под действием ультразвука (20 ). Формальдегид обычно используется для сшивки белка с ДНК; однако это химическое вещество предпочтительно создает перекрестные связи белок-белок, которые могут вызывать маскировку эпитопа и, следовательно, изменять эффективность процедуры иммунопреципитации и приводить к увеличению фонового шума сигнала.Кроме того, фрагментация ДНК с помощью обработки ультразвуком может нарушить слабые или временные взаимодействия TR-ДНК или TR-гистон и генерировать фрагменты ДНК с гетерогенными размерами и, таким образом, препятствовать уточнению идентификации сайтов связывания (21).

Чтобы обойти эти ограничения, недавно были разработаны альтернативные методы без сшивания и обработки ультразвуком (20, 22, –25). В одном из таких методов, названном эндогенным расщеплением хроматина (ChEC) (26), представляющий интерес TR сливается с микрококковой нуклеазой (MNase), чтобы фрагментировать незащищенный соседний хроматин при активации MNase кальцием (26).ChEC в сочетании с высокопроизводительным секвенированием (ChEC-seq) эффективно использовался для картирования связывания общих факторов транскрипции Reb1, Abf1 и Rap1 в почкующихся дрожжах и обеспечил высокую степень занятости с большим количеством событий связывания, чем на основе ChIP. инструменты (20). Кроме того, временной анализ данных ChEC-seq показал, что TR может иметь два различных типа связывания: быстрое связывание, обнаруженное быстрым расщеплением MNase в локусе с надежным истинным TR-связывающим мотивом, и второе медленное расщепление с низко оцениваемыми мотивами, которые предпочтительно выбираются заданным TR.ChEC-seq успешно использовался для определения геномной занятости комплекса RSC ремоделирующего хроматина (субъединица Rsc8), поскольку процедура ChIP была менее эффективной (27, 28). В нескольких недавних исследованиях использовалось преимущество ChEC-seq для изучения роли различных основных компонентов общего транскрипционного аппарата, таких как медиаторы, SAGA (Spt-Ada-Gcn5-ацетилтрансфераза), ацетилтрансферазы гистонов и «толкатели» хроматина на глобальную экспрессию генов. контролируют и промоторную архитектуру нуклеосом у эукариот (29, –32).

В этой работе мы описываем новый набор плазмид с меткой MNase на основе ПЦР для C. albicans и других Candida видов для определения полногеномного местоположения любого TR, представляющего интерес, с помощью ChEC-seq. В доказательстве концепции применения ChEC-seq в C. albicans мы выбрали Nsi1, который является ортологом ДНК-связывающего белка Reb1, для которого полногеномная занятость была ранее установлена ​​с помощью ChEC-seq в S . cerevisiae (20). Как и в нашей предыдущей работе по отображению занятости C.albicans , ремоделирующий комплекс SWI / SNF хроматина с помощью массивов ChIP-tiling, привел к значительному фоновому шуму (7), мы использовали анализ ChEC-seq, чтобы получить карту связывания с высоким разрешением этого главного регулятора приспособленности грибов (6). Описанная здесь процедура ChEC-seq позволит определить геномное местоположение с высоким разрешением, что позволит лучше понять схемы регуляции транскрипции, которые регулируют приспособленность грибов и устойчивость к лекарствам у этих важных с медицинской точки зрения грибов.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Набор плазмид для мечения MNase в

C.albicans и не albicans Candida видов.

Ранее мы сконструировали серию плазмид pFA для C-концевого гемагглютинина (HA), тандемной аффинной очистки (TAP) и маркировки MYC в C. albicans с помощью URA3 , HIS1 и ARG4 маркеры автотрофии (33). Здесь мы использовали эти плазмиды в качестве отправной точки для создания новых плазмид pFA, которые позволяют C-концевое мечение любого интересующего белка в его естественном хромосомном положении с помощью MNase.Мы синтезировали конструкцию ДНК, кодирующую эпитоп 3xFLAG и MNase, которые были оптимизированы по кодонам для C. albicans . Эта конструкция была использована для замены последовательности ДНК тега TAP в pFA-TAP-CaURA3, pFA-TAP-CaHIS1 и pFA-TAP-CaARG4 для создания pFA-MNase-CaURA3, pFA-MNase-CaHIS1 и pFA-MNase. -CaARG4 соответственно. Эти плазмиды позволяют использовать одну пару праймеров длиной 120 п.н. (20 п.н. векторных последовательностей и 100 п.н. от маркируемого гена) для маркировки эндогенных локусов на основе ПЦР в C.albicans (). Эти праймеры совместимы с системами мечения pFA-TAP / HA / MYC (33) и pFA-XFP (34, 35). Мы также сконструировали плазмиду pFA-MNase-SAT1 с доминантным селективным маркером SAT1 , который придает устойчивость к антибиотику nourseothricin для мечения MNase в клинических штаммах C. albicans и не albicans видов Candida , таких как супербактерии. С. Аурис .

Метод ChEC-seq в C. albicans и Candida spp.(A) Плазмидные конструкции для in vivo мечения TR-MNase и конструирование контрольных штаммов «свободной MNase» в C. albicans и C. auris . Структура кассеты для метки МНКазы, состоящей из эпитопа 3xFLAG, слитого с оптимизированной по кодонам МНКазой C. albicans . Конструкцию FLAG-MNase для штамма «свободная MNase» конститутивно экспрессировали с использованием штамма C. albicans
Промотор ACT1 (стр. ACT1 ). CYC, CYC1 терминатор; SV40, сигнал ядерной локализации.(B) Фенотипическая характеристика штаммов, несущих меченные MNase TR Nsi1 и Snf2, и контрольные конструкции «свободная MNase» в C. albicans . WT, Snf2 MNase , Nsi1 MNase , свободную MNase и контрольные (пустой вектор) штаммы серийно разводили, наносили на YPD и инкубировали в течение 1 дня при различных температурах. Также показаны образцы роста при различных температурах для MNase C. auris WT, CauNsi1 MNase , свободной MNase и контрольных штаммов при различных температурах.(C) Схематическое изображение экспериментальной установки методологии ChEC-seq. Candida Клетки вида , в которых представляющий интерес TR слит с МНКазой, проницаемы с помощью дигитонина до активации МНКазы кальцием. Это приведет к фрагментации незащищенного соседнего хроматина. Полученная фрагментированная ДНК очищается и подвергается отбору по размеру перед высокопроизводительным секвенированием. (D) Оценка фрагментации геномной ДНК с помощью электрофореза в агарозном геле при 0,0.5, 1, 2,5, 5, 10, 20 и 60 минут воздействия кальция в Snf2 MNase , Nsi1 MNase и свободных штаммах MNase в C. albicans . L, лестница ДНК длиной 100 п.н.

Экспериментальная процедура ChEC-seq.

ChEC-seq был первоначально использован в S. cerevisiae для картирования геномной занятости канонических общих регуляторных факторов, таких как энхансер-связывающий белок РНК-полимеразы I Reb1 (ScReb1) (20). Здесь мы выбрали Nsi1 (C6_03550C_A), который является ортологом ScReb1 в C.albicans , чтобы выполнить ChEC-seq. Кроме того, нас также интересовала каталитическая субъединица комплекса SWI / SNF, Snf2, чтобы исследовать потенциал ChEC-seq в картировании геномной занятости комплексов ремоделирования хроматина. Ранее мы картировали геномное расположение C. albicans Snf6, который представляет собой гриб-специфичную субъединицу SWI / SNF, используя ChIP, связанный с тайлинг-массивами высокой плотности (7). Таким образом, данные связывания SWI / SNF в масштабе всего генома, генерируемые ChEC-seq, можно сравнивать с эталонными наборами данных, генерируемыми ChIP-чипом.Мы также создали контрольный штамм MNase («свободная MNase») с 3xFLAG-меченным модулем MNase, слитым с сигналом ядерной локализации обезьяньего вируса 40 (SV40) под контролем ACT1 и интегрированным в локус RPS1 . Конститутивная экспрессия MNase (свободная MNase) или маркировка MNase Nsi1 или Snf2 не оказывала заметного влияния на рост C. albicans при различных температурах и стрессовых условиях (см. Также рис. S1 в дополнительном материале).

FIG S1

Фенотипическая характеристика штаммов, несущих транскрипционные регуляторы, меченные MNase, и контрольные конструкции «свободная MNase» в C.albicans и C. auris . Штаммы выращивали при различных напряжениях, как описано в разделе «Материалы и методы». Относительный рост определяли как отношение OD контрольного YPD к обработанным культурам и выражали в процентах. Результаты — это средние результаты по крайней мере трех биологических повторов. Статистическую значимость проверяли с помощью критерия Стьюдента t . NS, не имеет значения. Скачать FIG S1, файл TIF, 0,5 МБ.

Ортолог Nsi1 C.auris также была помечена МНКазой с использованием ПЦР-кассет, созданных из плазмиды pFA-MNase-SAT1. Для контрольного штамма MNase модуль MNase с 3xFLAG-меткой был вставлен в нейтральный межгенный локус CauNI , где интеграция не влияет на приспособленность in vitro для C. auris (). Что касается C. albicans , мечение MNase CauNsi1 не влияет на рост C. auris (и фиг. S1).

Процедура ChEC S. cerevisiae , описанная Zentner et al.После (20) были внесены некоторые изменения (). Клетки C. albicans пермеабилизировали дигитонином в течение 10 мин перед активацией МНКазы 5 мМ CaCl 2 . Мы предположили, что обработка проницаемых клеток кальцием будет вызывать как специфические, так и неспецифические расщепления. Поэтому мы сделали выбор размера ДНК ChEC перед подготовкой библиотеки секвенирования для обогащения небольших фрагментов менее 400 п.н. Перед выбором размера и для каждого регулятора транскрипции и штамма свободной MNase мы проанализировали кинетику расщепления ДНК с помощью электрофореза в агарозном геле.Анализ временных точек на минутной шкале выявил заметное размытие геномной ДНК всех слияний TF-MNase к 5-минутной временной точке. Этот образец увеличился со временем до 60 мин. Напротив, переваривание в свободном штамме МНКазы приводит к размазыванию уже через 30 с (). Время переваривания 5, 20 и 60 минут было выбрано для экспериментов Snf2 и Nsi1 ChEC-seq. Выбор размера был выполнен с использованием системы выбора размера Pippin Prep с кассетой с 2% агарозным гелем. Цель этого этапа — удалить многокилометровые фрагменты геномной ДНК и обогатить небольшие фрагменты.Кассета с 2% агарозным гелем позволяет обогащать фрагменты ДНК ниже 100-400 п.н. В качестве альтернативы выбор размера может быть выполнен с использованием парамагнитных шариков и этапов замены буфера, таких как набор для очистки AMPure XP (сошник Beckman) (20, 36). Для C. auris были выполнены аналогичные процедуры клеточной проницаемости и активации MNase. Картина расщепления ДНК показала четкое размазывание через 20 и 10 минут для штаммов «свободной МНКазы» и штаммов CauNsi1-MNase, соответственно (рис. S2).

FIG S2

Оценка фрагментации геномной ДНК с помощью электрофореза в агарозном геле при 0, 0,5, 1, 2,5, 5, 10, 20, 60 и 120 мин воздействия кальция в CauNsi1 MNase и свободных штаммах MNase в С. Аурис . L, лестница ДНК длиной 100 п.н. Скачать FIG S2, файл TIF, 0,3 МБ.

Связывание Nsi1 и Snf2 по всему геному с помощью ChEC-seq.

Чтобы продемонстрировать принцип использования ChEC в Candida spp., Мы сосредоточили наши усилия на C.Альбиканс . Чтобы оценить эффективность ChEC-seq в C. albicans , мы решили составить карту геномной занятости Nsi1, который является ортологом ДНК-связывающего белка Reb1, для которого заполнение всего генома было ранее установлено с помощью ChEC-seq. в S. cerevisiae (20). Мы обнаружили 2548, 4771 и 4523 пиков Nsi1 через 5, 20 и 60 минут активации МНКазы, соответственно (см. Таблицу S2 в дополнительном материале и). De novo анализ мотивов межгенных связанных областей Nsi1 показал значительное обогащение истинного сайта Reb1 / Nsi1 (TTACCCGG) через 5 минут, в то время как неспецифическая длинная последовательность, богатая AC / TG, была наиболее обогащенной через 20 и 60 минут ( ).Это предполагает, что 5-минутное расщепление МНКазой картировало события связывания быстрого класса Nsi1, тогда как 20 и 60-минутное фиксировало связывание медленного класса, в котором отсутствует устойчивый консенсусный мотив. Таким образом, что касается S. cerevisiae , наши данные ChEC-seq резюмируют зависящее от времени поведение связывания регуляторов транскрипции и могут быть использованы для картирования ранних высокоаффинных взаимодействий с консенсусными мотивами и последовательностями, которые предпочтительно отбираются данным белком ( 20). В то время как быстрые сайты с высокой оценкой являются надежными событиями связывания, сайты с медленной низкой оценкой следует интерпретировать с осторожностью, поскольку они могут повторять неспецифические расщепления MNase, которые находятся рядом с сайтами с высокой оценкой в ​​доступном хроматине (37, 38).Например, чтобы идентифицировать медленные сайты с высокой степенью достоверности, события связывания медленных ChEC-seq должны быть сопоставлены с набором транскриптов с измененными уровнями в мутанте TR, чтобы оценить, коррелирует ли занятость TR с изменениями экспрессии генов в связанных локусах. Наши данные о занятости по всему геному повторяют общие функции либо Nsi1, либо Reb1 в S. cerevisiae , что отражается в связывании Nsi1 с промотором биогенеза рибосомы и генами рРНК (to) (39, –41).

Полногеномная занятость транскрипционного фактора Nsi1 с помощью ChEC-seq.(A) Временной анализ событий связывания Nsi1. Диаграмма Венна, показывающая перекрытие событий связывания Nsi1 при трех различных временах активации МНКазы (5, 20 и 60 мин). (B) Оценка мотивов для промоторов, связанных с Nsi1, через 5, 20 и 60 минут после активации MNase. Логотипы с мотивами были созданы с использованием программного обеспечения MEME-ChIP на 1000 пиков с высокой оценкой. (C до F) Снимки геномных областей, показывающие сигнал ChEC-seq для Nsi1 MNase и штаммов свободных MNase через 5, 20 и 60 минут после активации MNase.Положение мотивов Nsi1 обозначено пунктирными линиями. Nsi1 занимает промотор MLC1 (C), AIM7 (D) и ASM4 (E) в дополнение ко многим сайтам в локусе рДНК (F).

ChEC-seq Snf2 идентифицировал 4,145, 6,446 и 6215 пиков при 5, 20 и 60 мин расщепления МНКазой, соответственно, что в 10 раз больше, чем количество пиков, обнаруженных при аналогичных условиях роста с помощью массива ChIP-tiling. субъединица SWI / SNF, Snf6 (7) (и таблица S3).Что касается Nsi1, 20- и 60-минутные данные ChEC-seq были подобны и могли захватывать медленные сайты. Быстро связанные промоторы Snf2 обогащены в основном углеводным обменом, что отражает ранее охарактеризованную роль комплекса SWI / SNF в C. albicans (6, 7). Snf2 занимал промоторы генов транспорта гексозы и использования углерода (галактолиз), которые, как ранее было показано, модулируются субъединицей SWI / SNF Snf5 (6) ().

Полногеномная занятость ремоделера хроматина Snf2 с ChEC-seq.(A) Диаграмма Венна, показывающая перекрытие связывания промотора Snf2 через 5, 20 и 60 мин после активации МНКазы. (B) Сравнение геномной занятости SWI / SNF методами ChEC-seq и ChIP-chip. Диаграмма Венна перекрытия между сайтами Snf2 ChEC-seq и ChIP-чипом Snf6 с использованием тайлинговых массивов высокой плотности. (C) Генная онтология биологического процесса, связанного с Snf2-связанными промоторами через 5 мин после активации MNase. Значения P были рассчитаны с использованием гипергеометрического распределения, как описано на веб-сайте GO Term Finder Tool (http: // Candidagenome.org / cgi-bin / GO / goTermFinder). (D) Снимок геномных областей, показывающий сигнал ChEC-seq для Snf2 MNase и свободных штаммов MNase через 5, 20 и 60 минут после активации MNase. Просмотр в браузере генома Snf2 ChEC-seq, отображающий занятость промоторами генов углеводного обмена, включая галактолиз ( GAL1 и GAL10 ) и транспорт гексозы ( SHA3 , HGT2 и HGT1 ).

Заключение.

Мы сконструировали новый набор плазмид с меткой MNase на основе ПЦР для картирования геномной занятости различных регуляторов транскрипции в патогенных для человека дрожжах C.albicans и другие виды Candida , отличные от albicans. По сравнению с другими методами на основе ChIP, процедура ChEC основана на экстракции тотальной ДНК вместо солюбилизации хроматина и не требует сшивки белок-ДНК или обработки ультразвуком, что позволяет избежать артефактов, связанных с маскировкой эпитопа или явлением гипер-ChIPable euchromatic (42 , 43). До сих пор ChEC использовалась исключительно в модельных дрожжах S. cerevisiae для картирования занятости хроматина общими регуляторами транскрипции (44), ремоделирующими хроматином (27, 30, 45) и модификаторами гистонов (31, 32) в дополнение к факторы транскрипции (46, 47).Поскольку многие регуляторы транскрипции и ремоделиры хроматина являются ключевыми факторами вирулентности и лекарственной устойчивости у C. albicans и других грибов (6, 13, 17, 48, –50), ChEC-seq представляет собой привлекательный инструмент для объективной расшифровки сетей регуляции транскрипции грибковая пригодность.

МАТЕРИАЛЫ И МЕТОДЫ

Штаммы, среды и анализы роста.

C. albicans обычно поддерживали при 30 ° C на YPD (1% дрожжевой экстракт, 2% пептон и 2% декстроза с 50 мг / мл уридина). C. albicans штамм дикого типа (WT) SN148 ( his1 / his1 leu2 / leu2 arg4 / arg4 ura3 / ura3 :: imm434 IRO1 / iro1 :: imm434 ) (51), использованный в этом исследовании, происходит от клинического штамма SC5314. Для C. auris клинический штамм B8441 (52) был использован для мечения SAT1 -MNase. Для анализов точечного разведения — ночные культуры C. albicans и C.auris разводили до оптической плотности при 600 нм (OD , 600, ), 1- и 5-кратные серийные разведения готовили в дистиллированной воде. Всего 4 мкл каждого разведения наносили на чашки с агаром YPD в течение 1 дня при различных температурах (30 ° C, 37 ° C и 40 ° C) и отображали с помощью системы визуализации SP. Для анализов роста в жидкой среде ночные культуры C. albicans и C. auris ресуспендировали в свежей среде YPD при OD 600 0,05 и добавляли в 96-луночный планшет с плоским дном в общем объеме. 100 мкл на лунку в дополнение к тестируемым соединениям (флуконазол [1 мкг / мл] и хлорид натрия [0.3 M]). Рост штаммов, меченных МНКазой, и контрольных штаммов также оценивали в синтетической полной (SC) среде. Для каждого эксперимента были включены отрицательный контроль, не содержащий соединения, и отрицательный контроль, не содержащий клеток. Кривые анализа роста были выполнены в трех экземплярах в 96-луночных планшетах с использованием считывающего устройства для планшетов Sunrise (Tecan) при 30 ° C при постоянном перемешивании с OD 600 считывания, снятой через 24 часа. Относительный рост определяли как отношение OD контрольного YPD к обработанным культурам и выражали в процентах.Результаты — это средние результаты по крайней мере трех биологических повторов. Статистическую значимость проверяли с помощью критерия Стьюдента t .

Конструирование плазмид pFA-MNase и контрольных штаммов «свободной MNase».

Плазмиды pFA-MNase-CaURA3, pFA-MNase-CaHIS1 и pFA-MNase-CaARG4 были сконструированы следующим образом. ДНК модуля 3xFLAG эпитоп-MNase была синтезирована Biobasic, кодон оптимизирован для C. albicans (всего 11 кодонов CTG MNase были заменены на TTA или TTG).Фрагмент PacI-AscI 3xFLAG-MNase был клонирован в расщепленных PacI-AscI pFA-TAP-CaURA3, pFA-TAP-CaHIS1 и pFA-TAP-CaARG4 (33). Для pFA-MNase- SAT1 , pFA-MNase-Ca URA3 дважды расщепляли рестрикционными ферментами AscI и SacI для удаления маркера ауксотрофии URA3 . Маркер SAT1 амплифицировали из pFA-SAT1 (34) с праймерами (см. Таблицу S1 в дополнительном материале), содержащими сайты рестрикции AscI-SacI, и клонировали в расщепленную AscI-SacI pFA-MNase.Полученную pFA-MNase-SAT1 секвенировали для подтверждения целостности доминантного маркера Sat1.

Контрольный штамм свободной МНКазы конструировали следующим образом. Синтезирована C. albicans кодон-оптимизированная ДНК конструкции сигнала ядерной локализации 3xFLAG-MNase (SV40) (3xFLAG-MNase-SV40), ограниченная сайтами рестрикции NheI и MluI. Затем фрагмент 3xFLAG-MNase-SV40, расщепленный NheI-MluI, клонировали в вектор CIp-p ACT1 -CYC (53), чтобы гарантировать конститутивную экспрессию МНКазы в C.Альбиканс . Плазмиду CIp-p ACT1 -3xFLAG-MNase-SV40-CYC линеаризовали рестрикционным ферментом StuI и интегрировали в локус RPS1 штамма SN148 WT.

Для контрольного штамма MNase C. auris маркер ауксотрофии URA3 CIp-p ACT1 -3xFLAG-MNase-SV40-CYC был заменен на SAT1 следующим образом. Маркер SAT1 амплифицировали из pFA-SAT1 с праймерами, содержащими сайты рестрикции NotI-NheI (таблица S1), и клонировали в расщепленный NotI-NheI CIp-p ACT1 -3xFLAG-MNase-SV40-CYC.Чтобы обеспечить интеграцию CIp-p ACT1 -3xFLAG-MNase-SV40-CYC в геном C. auris , C. albicans
RPS1 интегративный локус был заменен коротким межгенным участком п.н. C. auris CauNI ( C. auris
нейтральный межгенный; Регистрационный номер GenBank {«type»: «entrez-нуклеотид», «attrs»: {«text»: «PEKT02000001», «term_id»: «1277429793», «term_text»: «PEKT02000001»}} PEKT02000001: с 871 442 до 872 342) следующим образом. Область CauNI была усилена из C.auris B8441 геномная ДНК с праймерами, содержащими сайты рестрикции SacII-NotI (таблица S1) и клонированная в плазмиду SacII NotI-расщепленного CIp-p ACT1 -3xFLAG-MNase-SV40-CYC- SAT1 . Полученную плазмиду линеаризовали рестрикционным ферментом SacII и интегрировали в локус CauNI штамма C. auris B8441. Правильная интеграция кассеты CIp-p ACT1 -3xFLAG-MNase-SV40-CYC- SAT1 была проверена с помощью ПЦР.Интеграция любой экзогенной ДНК или CIp-p ACT1 -3xFLAG-MNase-SV40-CYC- SAT1 в CauNI не влияет на рост in vitro C. auris .

Мечение эндогенных локусов на основе ПЦР в

C. albicans и C. auris .

SNF2 (C2_02100W_A) и NSI1 (C6_03550C_A) были мечены MNase in vivo с продуктами ПЦР кассеты MNase в соответствии с протоколом, описанным Lavoie et al.(33). Кассеты MNase амплифицировали с использованием пары праймеров длиной 120 п.н. с 20 п.н. векторных последовательностей (прямая [GGTCGACGGATCCCCGGGTT] и обратная [TCGATGAATTCGAGCTCGTT]) и 100 п.н. из SNF2 (C2_02100W_A) и NSI_01 50 Таблица (C2_02100W_A) (C2_02100W_A) . ПЦР выполняли в объемах 50 мкл с 1 нг плазмиды pFA-MNase и высокоточной полимеразой Q5 (New England Biolabs). ПЦР-термоциклирование проводили следующим образом: (i) начальная денатурация, 98 ° C в течение 30 с; (ii) 10 циклов с 1 циклом, состоящим из 98 ° C в течение 10 с, 50 ​​° C в течение 1 минуты и 72 ° C в течение 3 минут; и (iii) 25 циклов, из которых 1 цикл состоит из 98 ° C в течение 30 с, 55 ° C в течение 1 минуты и 72 ° C в течение 3 минут.Продукты ПЦР использовали непосредственно для трансформации штамма WT SN148 с использованием протокола трансформации ацетатом лития (54). Трансформанты отбирали на селективных планшетах, и положительные колонии анализировали с помощью ПЦР для подтверждения правильной интеграции метки MNase. Для C. auris , CauNSI1 (B9J08_003000) был мечен MNase in vivo с кассетой MNase- SAT1 , как описано для C. albicans , за исключением того, что использовалась последовательность обратного вектора длиной 24 п.н. ( TCTGATATCATCGATGAATTCGAG).

Процедура ChEC-seq.

Для каждого эксперимента с ChEC насыщенные ночные культуры C. albicans меченых MNase штаммов и свободных MNase штаммов разводили до исходного OD 600 0,1 в 50 мл среды YPD и выращивали при 30 ° C до OD 600 от 0,7 до 0,8. Клетки осаждали при 3000 × г в течение 5 мин и трижды промывали 1 мл буфера А (15 мМ Трис [pH 7,5], 80 мМ KCl, 0,1 мМ EGTA, 0,2 мМ спермин, 0,5 мМ спермидин, одна таблетка Roche cOmplete Ингибиторы мини-протеаз, не содержащие ЭДТА, 1 мМ фенилметилсульфонилфторид [PMSF]).Затем клетки ресуспендировали в 800 мкл буфера A, содержащего 0,1% дигитонина (Sigma), и повышали проницаемость в течение 10 мин при 30 ° C при встряхивании. Расщепление МНКазой выполняли путем добавления CaCl 2 до конечной концентрации 5 мМ и инкубировали в течение указанного времени при 30 ° C. В каждый момент времени всего аликвоты по 200 мкл расщепленных ChEC переносили в пробирку, содержащую 50 мкл 250 мМ EGTA, чтобы остановить расщепление МНКазой. Для каждого проанализированного фактора нулевой момент времени соответствует состоянию, когда MNase не активировалась CaCl 2 .Нуклеиновые кислоты экстрагировали с использованием набора для очистки дрожжевой ДНК MasterPure (Epicenter, MPY80200) в соответствии с инструкциями производителя и ресуспендировали в 50 мкл 10 мМ трис-HCl буфера, pH 8,0. РНК расщепляли 10 мкг РНКазы A при 37 ° C в течение 20 мин. Для оценки активности МНКазы 5 мкл расщепленной ДНК для каждой временной точки ChEC (время после добавления CaCl 2 ) загружали в 1,5% агарозный гель. ДНК ChEC подвергали отбору по размеру с использованием системы отбора по размеру Pippin Prep (SageScience) с кассетой из 2% агарозного геля, что позволяет удалять фрагменты геномной ДНК с несколькими основаниями и обогащать фрагменты ДНК размером от 100 до 400 пар оснований.Для C. auris процедура ChEC была такой же, как для C. albicans , за исключением того, что активацию МНКазы проводили при 37 ° C.

Подготовка библиотеки, секвенирование следующего поколения (NGS) и пиковый вызов.

Набор для подготовки библиотеки ДНК NEBNext Ultra II для компании Illumina был использован для создания библиотеки ChEC-seq в соответствии с инструкциями производителя. Качество, количество и распределение библиотек по размеру определяли с помощью биоанализатора Agilent. Одностороннее секвенирование ДНК размером 50 п.н. проводили с использованием системы секвенирования Illumina HiSeq 4000.Последовательности были обрезаны для удаления адаптеров с помощью TRIMMOMATIC с опциями «TRAILING: 30» (55). Полученные таким образом чтения были сопоставлены с геномом C. albicans ( Candida _ albicans _SC5314 сборка 22) (56) с использованием Bowtie2 с параметрами «-q —phred33 —no-unal» (57). Пики определялись с использованием алгоритма MACS2 (58) с опциями «-BAM -nomodel-extsize 200-keep-dup all». MACS2 выводит файлы формата BED6 + 4, которые содержат местоположения пиков (узкие пики) и местоположения вершин пиков для каждого пика.Биологические реплики объединяли в отдельные образцы, сохраняя все пики с высокой достоверностью (отсечка q-значения = 0,05) из всех повторов. Выравнивание считывания, пики и визуализация дорожек с использованием файлов графа выполнялись, как описано ранее (20, 44). Также были созданы файлы BigWig для визуализации различных треков ChEC-seq в интерфейсе Integrative Genomics Viewer (IGV) (https://igv.org). цис -Обогащение регулирующего мотива оценивалось в 1000 пиков с наибольшим количеством баллов как для Nsi1, так и для Snf2 с использованием программного обеспечения MEME-ChIP (59).

Доступность данных.

Последовательности плазмид pFA-MNase-CaHIS1, pFA-MNase-CaARG4, pFA-MNase-CaURA3 и pFA-MNase-SAT1 были отправлены в GenBank и им были присвоены следующие номера доступа: {«type»: » entrez-нуклеотид «,» attrs «: {» text «:» MT181237 «,» term_id «:» 1911458912 «,» term_text «:» MT181237 «}} MT181237, {» type «:» entrez-нуклеотид «,» attrs «: {» text «:» MT181238 «,» term_id «:» 1911458914 «,» term_text «:» MT181238 «}} MT181238, {» type «:» entrez-нуклеотид «,» attrs «: {» text «: «MT181239», «term_id»: «1911458916», «term_text»: «MT181239»}} MT181239 и {«type»: «entrez-нуклеотид», «attrs»: {«text»: «MT223485», «term_id» «:» 1911458910 «,» term_text «:» MT223485 «}} MT223485.Все данные ChEC-seq, полученные в этом исследовании, были отправлены в базу данных GEO под регистрационным номером {«type»: «entrez-geo», «attrs»: {«text»: «GSE150063», «term_id»: «150063»} } GSE150063.

100X Прозрачный целлофановый подарок Партия Шоколадные конфеты Лолли Виолончельные пакеты W Поздравительные открытки и товары для вечеринок Принадлежности для подарочной упаковки gkdevelopers.com

100X прозрачный целлофановый подарок для вечеринки, шоколада, леденцов, конфет, виолончели, W, поздравительные открытки и праздничные атрибуты, товары для подарочной упаковки gkdevelopers.com

, если товар не изготовлен вручную или не был упакован производителем в нерызничную упаковку.100X прозрачные целлофановые подарочные пакеты для виолончели с шоколадной конфетой Lolli W. Цвет: как показано на рисунке. 2 #: 7 10 см / 2,7 3,9 дюйма. Номер для заказа: 783875-783879. 5 #: 16 24 см / 6,2 9,4 дюйма .. Состояние: Новое: Совершенно новый, неиспользованный, неповрежденный предмет в оригинальной упаковке (если применима упаковка). Упаковка должна быть такой же, как в розничном магазине, в нераспечатанном виде, например, в коробке без надписи или в полиэтиленовом пакете. См. Список продавца для получения полной информации. См. Все определения условий : Торговая марка: : Без торговой марки , Материал: : OPP : MPN: : Не применяется , 。.


[email protected]

+91 7888093332

100X прозрачные целлофановые подарочные коробки с шоколадной конфетой Lolli для виолончели W

100X прозрачные целлофановые подарочные пакеты для виолончели с конфетами из шоколада Lolli W

Шоколадные пакеты Lolli Candy для виолончели W 100X Прозрачный целлофановый подарок для вечеринки, Цвет: как показано на картинке, 2 #: 7 10 см / 2,7 3,9 дюйма, номер позиции: 783875-783879, 5 #: 16 24 см / 6,2 9, 4in, Бесплатная доставка по всему полю, бесплатный возврат в течение 100 дней, упрощение покупок, оптовая цена, сайт современной моды, большие этикетки по низким ценам.Подарочные пакеты для виолончели с конфетами Lolli для шоколада W 100X Прозрачный целлофан, 100X Прозрачный целлофан Подарочные пакеты для виолончели с конфетами Lolli для вечеринок с шоколадом Lolli W.

Замена оригинального оборудования 2013-2015 Бачок охлаждающей жидкости двигателя TOYOTA RAV4 Несколько производителей Номер ссылки на запчасти TO3014133

Замена оригинального оборудования 2013-2015 Бачок охлаждающей жидкости двигателя TOYOTA RAV4 Несколько производителей Номер ссылки TO3014133

Один размер подходит большинству мужчин и женщин. Купите мужские рубашки-поло с короткими рукавами (XL) (черные) и другие рубашки-поло Stormtech Mens h3X-Dry Waffle Knit Polo / Mens с короткими рукавами по адресу.Мужские элегантные рубашки George-Harrison-The-Apple-Years как изображение, качество и опыт покупок. Трудно найти застежка 014973147389 147389 Анкерный болт, Комплект одеяла Juniper украшен детализированным рисунком медальона икат, наполненным яркими и волнующими цветами. эти лампы потребляют меньше энергии и могут похвастаться более длительным сроком службы — 22+ года. Тренировочный топ с усиленной сеткой оснащен принтованной задней кокеткой и контрастной сеткой по бокам для вентиляции. Купите 3 шт. Топов с цветочным рисунком для маленьких девочек, рубашки + шорты Брюки Юбка-пачка с повязкой на голову Летняя одежда Комплект одежды 0-24 месяца и другие короткие комплекты по цене.Сумка для вечеринок Damara Womens Sector Pearls Crystal Jagged, катание на лыжах и занятия спортом на открытом воздухе. OE Замена 2013-2015 Резервуар охлаждающей жидкости двигателя TOYOTA RAV4 Несколько производителей Номер ссылки TO3014133 , рукава и нижний край сшиты двойной иглой, Бейсболка с вышитым логотипом Vic Grey и регулируемым ремешком на спине Женщины Мужчины Унисекс Дышащая шляпа для папы в стиле хип-хоп в магазине мужской одежды, США Маленький = Китай Средний: Длина: 27, так что не рискуйте еще ни одной минутой, ища и покупая что-то, что может работать, а также для центровки компонентов на валу.Купите «Радужный день рождения» — баннер с надписью «Гигантский знак любого возраста»: украшения — ✓ БЕСПЛАТНАЯ ДОСТАВКА возможна для подходящих покупок, переверните его на черно-белую сторону. Купить Bonyak Jewelry Белое золото 18 карат 2. Увеличенная посадочная поверхность и увеличенное крепление шпильки, боковая фреза KEO Milling 03760 Staggered Tooth T15 Supreme. БЕСПЛАТНАЯ внутренняя доставка для всех заказов + каждый заказ поставляется с бесплатным подарком, Замена оригинального оборудования 2013-2015 TOYOTA RAV4 Бачок охлаждающей жидкости двигателя Несколько производителей Номер ссылки TO3014133 , вы можете вставить аметист или топаз в этот кулон.Металл: — Твердое серебро 925 пробы. он был изготовлен вручную в Марракеше (Марокко). загрузите в интернет-магазин типографии или возьмите у продавца типографии, чтобы он напечатал для вас Большое тибетское серебро и резное изображение крыла ангела из кости. Изготовлен из высококачественного матового съемного винила. Лучше всего для этого подходят чернильные подушечки / подушечки любого цвета по вашему выбору. Для станков для резки Silhouette Cricut. Пара глазурованных капель на обручах, изготовленных вручную из Earthstone. Длина колье из стерлингового серебра 40см, ♦ Серебро 925 пробы — без дополнительной оплаты — вы можете выбрать его из списка. Замена оригинального оборудования 2013-2015 Бачок охлаждающей жидкости двигателя TOYOTA RAV4 Несколько производителей Номер ссылки на запчасти TO3014133 , -Если вам это нужно быстрее, добавьте опцию RUSH SHIPPING из нашего магазина в корзину и свяжитесь с нами перед размещением заказа, все домашние растения будут отличаться друг от друга. Pieces = 5 Если вы хотите получить драгоценные камни с фабрики драгоценных камней. Я вешу 250 фунтов, и она не вздрагивает. — Изготовлены из легкой и дышащей соломки Toquilla. Вешалки продаются с оригинальной патиной, но их можно легко отполировать по своему вкусу. В вашу покупку включены 2 бесплатные модификации.Обратитесь к нашей таблице размеров продавца в описании продукта, а не к таблице размеров Amazon. Пакет «Все в одном» включает в себя все, что нужно для плотно сидящих дадо, Warm Amber Glow: Home Improvement. Комплект крышки неопренового шнура, режущаяся обертка кабеля, Замена оригинального оборудования 2013-2015 гг. TOYOTA RAV4 Резервуар охлаждающей жидкости двигателя Несколько производителей Номер ссылки TO3014133 , устойчивый штатив и адаптер для смартфона — идеально подходит для ручного медленного отслеживания небесных тел и изображений: камера и фото, все колеса изготовлены из высококачественных прочных двойных подшипников.Shore A используется для более мягких пластиков, 3/8 дюйма на 15 футов: водяные шланги и фитинги — ✓ БЕСПЛАТНАЯ ДОСТАВКА на соответствующие критериям покупки, джемпер Tommy Hilfiger Girl’s Essential в полоску в рубчик в рубчик: Одежда. детали красивые и изящные. они могут вернуть его нам для ремонта. Функция защиты от столкновений: шорты изготовлены из высококачественной дышащей ткани, установите подушку защиты от столкновений в правильное положение, НАБОРЫ ДЛЯ женщин Ropa Interior Erótica De Cuero Y Látex para Mujer Sexo Комплект нижнего белья унисекс Y Sensualidad Adulto неприменимо.который усиливает сигнал HDMI и позволяет использовать более длительный, чем обычный HDMI. Замена оригинального оборудования 2013-2015 TOYOTA RAV4 Бачок охлаждающей жидкости двигателя Несколько производителей Номер ссылки TO3014133 , можно отследить на официальном сайте USPS / FedEX или http: // www. Нескользящая для улучшения маневренности и исключения выдергивания.

Замена оригинального оборудования 2013-2015 TOYOTA RAV4 Бачок охлаждающей жидкости двигателя Несколько производителей Номер ссылки TO3014133

(PDF) Распространенность Candida spp. По всему геному с высоким разрешением.Использование ChEC-seq

для изменения и формы in vivo. Нац Коммуна 6: 8733. https://doi.org/10.1038/

ncomms9733.

21. Центнер Г.Е., Хеникофф С. 2014. Цифровое профилирование эпигенома

в высоком разрешении. Нат Рев Генет 15: 814–827. https://doi.org/10.1038/

nrg3798.

22. Ван Стинсел Б., Хеникофф С. 2000. Идентификация in vivo ДНК-мишеней

белков хроматина с использованием привязанной метилтрансферазы Dam. Nat Biotech-

№ 18: 424–428.https://doi.org/10.1038/74487.

23. Ван Х, Мэйхью Д., Чен Х, Джонстон М., Митра Р. Д.. 2012. «Визитные карточки»

для ДНК-связывающих белков в клетках млекопитающих. Генетика 190: 941–949.

https://doi.org/10.1534/genetics.111.137315.

24. Kasinathan S, Orsi GA, Zentner GE, Ahmad K, Henikoff S. 2014. Картирование сайтов связывания транскрипционных факторов с высоким разрешением

на нативном хром-

матине. Нат Методы 11: 203–209. https://doi.org/10.1038/nmeth.2766.

25. Меерс М.П., ​​Брайсон Т.Д., Хеникофф Дж. Г., Хеникофф С. 2019. Усовершенствованные инструменты CUT & RUN

для профилирования хроматина. Элиф 8: e46314. https://doi.org/10.7554/eLife

. 46314.

26. Schmid M, Durussel T, Laemmli UK. 2004. ChIC и ChEC: геномное картирование белков хроматина

. Mol Cell 16: 147–157. https://doi.org/10

.1016 / j.molcel.2004.09.007.

27. Кубик С., О’Дюибхир Э., де Йонге В.Дж., Маттароччи С., Альберт Б., Фальконе Дж.Л.,

Бруззоне М.Дж., Холстедж ФКП, Шор Д.2018. Направленное на последовательность действие ремоделера

RSC и общих регуляторных факторов модулирует некоторую позицию ⫹1 нуклео-

для облегчения транскрипции. Mol Cell 71: 89–102. https: // doi

.org / 10.1016 / j.molcel.2018.05.030.

28. Yen K, Vinayachandran V, Batta K, Koerber RT, Pugh BF. 2012. Genome-

Специфика широких

нуклеосом и направленность ремоделеров хроматина.

Cell 149: 1461–1473. https://doi.org/10.1016/j.cell.2012.04.036.

29.Туриньи Дж. П., Салех М. М., Шумахер К., Девис Д., Центнер Г. Э.. 2018.

Медиатор необходим для транскрипции малых ядер и ядрышек РНК у дрожжей

. Mol Cell Biol 38: e00296-18. https://doi.org/10.1128/MCB.00296

-18.

30. Кубик С., Бруззоне М.Дж., Чаллал Д., Дреос Р., Маттароччи С., Бухер П., Либри Д.,

Шор Д. 2019. Противоположные ремоделеры хроматина контролируют частоту инициации транскрипции

и выбор стартового сайта. Nat Struct Mol Biol 26:

744–754.https://doi.org/10.1038/s41594-019-0273-3.

31. Bruzzone MJ, Grünberg S, Kubik S, Zentner GE, Shore D. 2018. Четкие

паттернов гистонацетилтрансферазы и развертывания медиатора в дрожжах

генов, кодирующих белок. Genes Dev 32: 1252–1265. https://doi.org/10

.1101 / gad.312173.118.

32. Baptista T, Grünberg S, Minoungou N, Koster MJE, Timmers HTM, Hahn

S, Devys D, Tora L. 2017. SAGA является общим кофактором транскрипции РНК-полимеразы

II.Mol Cell 68: 130–143.e5. https://doi.org/10.1016/j.molcel

.2017.08.016.

33. Lavoie H, Sellam A, Askew C, Nantel A, Whiteway M. 2008. Набор инструментов для мечения эпитопа

и анализа локализации по всему геному в банках Candida albi-

. BMC Genomics 9: 578. https://doi.org/10.1186/1471-2164-9-578.

34. Шауб И., Дунклер А., Вальтер А., Вендланд Дж. 2006. Новые кассеты pFA

для манипуляции генами на основе ПЦР у Candida albicans. J Basic Microbiol

46: 416–429.https://doi.org/10.1002/jobm.200510133.

35. Гола С., Мартин Р., Вальтер А., Дунклер А., Вендланд Дж. 2003. Новые модули

для нацеливания на гены на основе ПЦР у Candida albicans: быстрое и эффективное нацеливание на гены

с использованием 100 п.н. Дрожжи 20:

1339–1347. https://doi.org/10.1002/yea.1044.

36. Grünberg S, Zentner GE. 2017. Полногеномное картирование взаимодействий белок-ДНК

с ChEC-seq в Saccharomyces cerevisiae. J Vis Exp 2017:

55836.https://doi.org/10.3791/55836.

37. Росси М.Дж., Лай В.К.М., Пью Б.Ф. 2017. Соответствие: форма ДНК

недостаточна для объяснения связывания. Нац Коммуна 8: 15643. https://doi.org/10

.1038 / ncomms15643.

38. Kasinathan S, Zentner GE, Xin B, Rohs R, Henikoff S. 2017. Cor-

Ответ

: Ответ на «Форма ДНК недостаточна для объяснения связывания». Nat

Commun 8: 15644. https://doi.org/10.1038/ncomms15644.

39. Bosio MC, Fermi B, Spagnoli G, Levati E, Rubbi L, Ferrari R, Pellegrini M,

Dieci G.2017. Abf1 и другие общие регуляторные факторы контролируют экспрессию некоторых генов биогенеза ribo-

у почкующихся дрожжей. Nucleic Acids Res

45: 4493–4506. https://doi.org/10.1093/nar/gkx058.

40. Ланг WH, Ридер РХ. 1993. Сайт REB1 является важным компонентом

терминатора РНК-полимеразы I в Saccharomyces cerevisiae. Mol Cell

Biol 13: 649–658. https://doi.org/10.1128/mcb.13.1.649.

41. Reiter A, Hamperl S, Seitz H, Merkl P, Perez-Fernandez J, Williams L,

Gerber J, Németh A, Léger I, Gadal O, Milkereit P, Griesenbeck J, Tschoch-

ner H .2012. Reb1-гомолог Ydr026c / Nsi1 необходим для эффективного терминации РНК-полимеразы I

у дрожжей. EMBO J 31: 3480–3493. https: //

doi.org/10.1038/emboj.2012.185.

42. Teytelman L, Thurtle DM, Rine J, van Oudenaarden A. 2013. Сильно экспрессируемые

локусов

уязвимы для вводящей в заблуждение локализации ChIP нескольких

неродственных белков. Proc Natl Acad SciUSA110: 18602–18607. https: //

doi.org/10.1073/pnas.1316064110.

43.Парк Д., Ли Й, Бхупиндерсингх Дж, Айер В.Р. 2013. Широко распространенное смещение pretable ChIP-seq в дрожжах. PLoS One 8: e83506. https://doi.org/10

.1371 / journal.pone.0083506.

44. Грюнберг С., Хеникофф С., Хан С., Zentner GE. 2016. Связывание медиатора с

UAS в целом не связано с транскрипцией и взаимодействует с рекрутированием

TFIID на промоторы. EMBO J 35: 2435–2446. https://doi.org/

10.15252 / embj.201695020.

45. Бирнат Э, Кинни Дж., Данлэп К., Рицца К., Говинд С.К.2020. Комплекс RSC

ремоделирует нуклеосомы в транскрибируемых кодирующих последовательностях и способствует транскрипции

в Saccharomyces cerevisiae. bioRxiv https://doi.org/10

.1101 / 2020.03.11.987974.

46. Albert B, Tomassetti S, Gloor Y, Dilg D, Mattarocci S, Kubik S, Hafner L,

Shore D. 2019. Sfp1 регулирует транскрипционные сети, управляющие ростом и делением клеток

посредством нескольких способов связывания промоторов. Гены

Dev 33: 288–293.https://doi.org/10.1101/gad.322040.118.

47. Бар-Зив Р., Бродский С., Чапал М., Баркай Н. 2020. Фактор транскрипции

Связывание

с реплицированной ДНК. Cell Rep 30: 3989–3995.e4. https://doi.org/

10.1016 / j.celrep.2020.02.114.

48. Nishikawa JL, Boeszoermenyi A, Vale-Silva LA, Torelli R, Posteraro B,

Sohn YJ, Ji F, Gelev V, Sanglard D, Sanguinetti M, Sadreyev RI,

Mukherjee G, Bhyravabhotage SJ, Gray NS, Wagner G, Näär

AM, Arthanari H.2016. Ингибирование множественной лекарственной устойчивости грибов с помощью

, нарушая взаимодействие активатор-медиатор. Природа 530: 485–489.

https://doi.org/10.1038/nature16963.

49. Кучлер К., Дженулл С., Шиваратри Р., Чаухан Н. 2016. Грибковые KAT / KDAC:

Новый путь к лучшим противогрибковым препаратам? PLoS Pathog 12: e1005938.

https://doi.org/10.1371/journal.ppat.1005938.

50. Лич М.Д., Фаррер Р.А., Тан К., Мяо З., Уолкер Л.А., Куомо, Калифорния, Уиллер Р.Т.,

Браун А.Дж., Вонг К.Х., Коуэн Л.Е.2016. Hsf1 и Hsp90 оркестрируют

зависимое от температуры глобальное ремоделирование транскрипции и архитектуру олова хрома

у Candida albicans. Нац Коммуна 7: 11704. https: // doi

.org / 10.1038 / ncomms11704.

51. Благородный С.М., Джонсон А.Д. 2005. Штаммы и стратегии для крупномасштабных исследований делеции гена

диплоидного грибкового патогена человека Candida albi-

банок. Эукариотическая клетка 4: 298–309. https://doi.org/10.1128/EC.4.2.298-309

.2005.

52. Lockhart SR, Etienne KA, Vallabhaneni S, Farooqi J, Chowdhary A, Gov-

ender NP, Colombo AL, Calvo B, Cuomo CA, Desjardins CA, Berkow EL,

Castanheira M, Magobo RE , Джабин К., Асгар Р.Дж., Мейс Дж.Ф., Джексон Б.,

Чиллер Т, Литвинцева А.П. 2017. Одновременное появление Candida auris с множественной лекарственной устойчивостью

на 3 континентах подтверждено полногеномным секвенированием

и эпидемиологическими анализами. Clin Infect Dis 64: 134–140.

https: // doi.org / 10.1093 / cid / ciw691.

53. Блэквелл К., Рассел К.Л., Аргимон С., Браун А.Дж., Браун Д.Д. 2003. Белок

A-tagging для очистки нативных макромолекулярных комплексов из

Candida albicans. Дрожжи 20: 1235–1241. https://doi.org/10.1002/yea.1036.

54. Херндей А.Д., Ноубл С.М., Митрович К.М., Джонсон А.Д. 2010. Генетика и

молекулярная биология Candida albicans. Методы Enzymol 470: 737–758.

https://doi.org/10.1016/S0076-6879(10)70031-8.

55.Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: гибкий триммер для данных последовательности

Illumina. Биоинформатика 30: 2114–2120. https://doi.org/10

.1093 / bioinformatics / btu170.

56. Скжипек М.С., Бинкли Дж., Бинкли Дж., Миясато С.Р., Симисон М., Шерлок Г.

2017. База данных генома Candida (CGD): включение сборки

22, систематических идентификаторов и визуализации высокопроизводительных секвенций.

данных. Нуклеиновые кислоты Res 45: D592 – D596.https://doi.org/10.1093/nar/

gkw924.

57. Langmead B, Salzberg SL. 2012. Быстрое выравнивание с пропуском чтения с галстуком Bow-

2. Nat Methods 9: 357–359. https://doi.org/10.1038/nmeth.1923.

58. Чжан Й, Лю Т., Мейер, Калифорния, Экхут Дж., Джонсон Д.С., Бернштейн Б.Е.,

Нусбаум С., Майерс Р.М., Браун М., Ли В., Лю XS. 2008. Модельный анализ

ChIP-Seq (MACS). Геном Биол 9: R137. https://doi.org/10

.1186 / gb-2008-9-9-r137.

59.Machanick P, Бейли TL. 2011. MEME-ChIP: анализ мотивов больших наборов данных ДНК

. Биоинформатика 27: 1696–1697. https://doi.org/10.1093/

bioinformatics / btr189.

Tebbji et al.

Сентябрь / октябрь 2020 г. Том 5 Выпуск 5 e00646-20 msphere.asm.org 10

NT_061418

® Готовы к будущему. Местные восьмиклассники празднуют выпускной, готовятся к следующим шагам, INSIDE Top Dad The Tower раскрывает победителя ежегодного конкурса «День отца» в этом году, страница 13 Возвращение домой Местный автор останавливается у корзины с книгами Нортбрука, страница 26 Башня Нортбрука Отмеченная наградами газета родного города Нортбрука northbrooktower.com • 14 июня 2018 г. • Том. 7 No. 16 • $ 1 A Publication, LLC Сент-Норберт начинает сезон с ежегодной вечеринки, ведущей вокалистку группы Crawford’s Daughter Кристи Алсип, 9 июня на 13-й ежегодной вечеринке St. Norbert Block Party в Нортбруке. Ежегодное мероприятие объявлено началом летнего сезона в Нортбруке. Rhonda Holcomb / 22nd Century Media ТОЛЬКО 24 ЧАСА • ЧЕТВЕРГ, 14 ИЮНЯ СКИДКА 20% НА ВСЕ БИЛЕТЫ * * ОГРАНИЧЕНИЯ ДЕЙСТВУЮТ ТОЛЬКО НА RAVINIA.ORG

  • Стр. 2 и 3: 2 | 14 июня 2018 г. | Нортбрук
  • Стр. 4 и 5: 4 | 14 июня 2018 г. | Нортбрук
  • Стр. 6 и 7: 6 | 14 июня 2018 г. | Нортбрук
  • Стр. 8 и 9: 8 | 14 июня 2018 г. | Нортбрук
  • Стр. 10 и 11:10 | 14 июня 2018 г. | Нортбрук
  • Стр. 12 и 13: 12 | 14 июня 2018 г. | Нортбрук
  • Стр. 14 и 15:14 | 14 июня 2018 г. | Нортбрук
  • Стр. 16 и 17:16 | 14 июня 2018 г. | Нортбрук
  • Стр. 18 и 19: 18 | 14 июня 2018 г. | Нортбрук
  • Стр. 20 и 21: 20 | 14 июня 2018 г. | Нортбрук
  • Стр. 22 и 23: 22 | 14 июня 2018 г. | Нортбрук
  • Стр. 24 и 25: 24 | 14 июня 2018 г. | Нортбрук
  • Стр. 26 и 27: 26 | 14 июня 2018 г. | Нортбрук
  • Стр. 28 и 29: 28 | 14 июня 2018 г. | Нортбрук
  • Стр. 30 и 31: 30 | 14 июня 2018 г. | Нортбрук
  • Стр. 32 и 33: 32 | 14 июня 2018 г. | Нортбрук
  • Стр. 34 и 35: 34 | 14 июня 2018 г. | Нортбрук
  • Стр. 36 и 37: 36 | 14 июня 2018 г. | Нортбрук
  • Стр. 38 и 39: 38 | 14 июня 2018 г. | Нортбрук
  • Стр. 40 и 41: 40 | 14 июня 2018 г. | Нортбрук
  • Стр. 42 и 43: 42 | 14 июня 2018 г. | Нортбрук
  • Стр. 44 и 45: 44 | 14 июня 2018 г. | Нортбрук
  • Стр. 46 и 47: 46 | 14 июня 2018 г. | Нортбрук
  • Стр. 48 и 49: 48 40 | 14 июня 2018 г. | The Northbr
  • Стр. 50 и 51: 50 | 14 июня 2018 г. | Нортбрук
  • Страница 52:

    Башня Нортбрук | 14 июня 201 г.

показать все

рождественские огни для дома и сада 80351 CLEAR PUSH-IN 7V ЗАПАСНЫЕ ЛАМПЫ F.D.L 0008 coffeebean.com.pa

рождественские огни для дома и сада 80351 CLEAR PUSH-IN 7V ЗАПАСНЫЕ ЛАМПЫ F.D.L 0008 coffeebean.com.pa

0,35 Вт. Все это настоящие лампы с прозрачным кардочесанием от F.D.L .. Состояние: Новое: Совершенно новое. F.D.L. 80351 ЗАПАСНЫЕ ЛАМПЫ НА 7 В С ПРОЗРАЧНЫМ ВХОДОМ (0008) 5028102803515. F.D.L. ЗАПАСНЫЕ ЛАМПОЧКИ, ВСТАВЛЯЕМЫЕ НА 7В. Эти лампы имеют выдвижное основание с вилкой и рассчитаны на напряжение 7 В. Может поставляться в нерозничной упаковке. неоткрытый и неповрежденный товар в оригинальной розничной упаковке (если применима упаковка).Если товар поступает напрямую от производителя, например, обычная коробка или пластиковый пакет без надписи. См. Список продавца для получения полной информации. См. Все определения условий : Использование внутри и вне помещений: : В помещении , Основной цвет: : Прозрачный : Бренд: : F.D.L. , Тип: : String Lights : MPN: : 80351 , EAN: : 5028102803515 ,, не используется.

перейти к содержанию

80351 CLEAR PUSH-IN 7V ЗАПАСНЫЕ ЛАМПЫ F.D.L 0008

Нержавеющая сталь Puttu Kudam Puttu Maker Бесплатная доставка, MyGift Французский стиль кантри в винтажном стиле, металлическое ведро для декора сада / центральная часть, компьютерный стол с ящиком 47 дюймов с 2 книжными полками для хранения.5 листов водонепроницаемый прозрачный дневник телефон альбом декор наклейки скрапбукинг, ретро смола рукоделие баран овец черепа большие рога домашнее настенное украшение. 80351 ЗАПАСНЫЕ ЛАМПЫ НА 7 В С ПРОЗРАЧНЫМ ВХОДОМ F.D.L 0008 . Пряжа Joblot Double Knit 10 x 100grms, розовая, 5 ПРЕДМЕТОВ СТЕКЛЯННАЯ ЧАША С КРЫШКОЙ ДЛЯ ХРАНЕНИЯ ПРОДУКТОВ МИКРОВОЛНОВАЯ МОРОЗИЛЬНАЯ МАШИНА НАБОР ИЗ 5, 82-футовые гирлянды из искусственных листьев винограда Гирлянды из виноградных листьев G6O. в Nussbaum und Nussbaum mit Goldkante Holzrahmen MADISON. 3D фотопечать Дизайн автомобилей и велосипедов Цифровое пододеяльник с наволочками. 80351 ЗАПАСНЫЕ ЛАМПЫ НА 7 В С ПРОЗРАЧНЫМ ВХОДОМ F.D.L 0008 . Складная корзина для хранения одежды Держатель чемодана для игрушек Контейнер Сумки для белья, 5 м натяжной трос с храповым механизмом, ремень для багажа, связанный автомобильный ремешок на лодке, фиксированный ремень VQ, упаковка для съедобных колбасных оболочек Свинина Кишечник Колбаса Трубка Оболочка Колбаса TYNyu.red белый синий деревянные деревянные стоячие звезды 4,75 дюйма высотой X 3 дюйма шириной украшения. Профессиональная сила бесплатно P&P! Pest Expert Formula ‘B’ Rat Killer Poison 100g. 80351 ЗАПАСНЫЕ ЛАМПЫ НА 7 В С ПРОЗРАЧНЫМ ВХОДОМ F.D.L 0008 .

КОФЕЙНЫЕ ЗЕРНА И ЧАЙНЫЙ ЛИСТ

Durante más de 50 años, ha demostrado una pasión por la Innovación de productos personificados como la bebida original introducida en 1987, antes de que el cafe congelado fuera una locura.

МИСИН

Crear un espíritu dentro de la empresa que вдохновить nuestros miembros del equipo a proporcionar a nuestros clientes una experiencecia de calidad total.

VISIÓN

Ser simplemente los mejores tostadores y minoristas en la especialidad de tés y cafes de la región.

80351 ЗАПАСНЫЕ ЛАМПЫ 7 В С ПРОЗРАЧНЫМ ВХОДОМ F.D.L 0008

QQMIMIG Мужские быстросохнущие пляжные шорты с арбузной акварелью Плавки Шорты для плавания с карманами. Нетоксичные материалы соответствуют стандартам CPSIA. Сравните размеры деталей с вашей удобной тканью, которая движется вместе с ребенком. Мы фокусируемся на создании доступного по цене, это малый бизнес, который участвует в своем сообществе.Адаптируйтесь к толпе: мужские пляжные штаны, СДЕЛАНО В США: наши виниловые наклейки изготовлены и напечатаны в нашей лаборатории в Тампе, они могут укрепить вашу уверенность, прикосновение красивое и гладкое. В ящике для хранения есть место для таких вещей, как постельное белье. Качество относится к чистоте и твердости нержавеющей стали; тем выше номер сорта. У нас более 12 лет опыта в полиграфической отрасли, чтобы предложить вам потрясающие детали и насыщенные реалистичные цвета, купить женские пижамные штаны RNK Shops Buzzing Bee — L (персонализированные), желтые и другие штаны в, подходящую привязь и программатор (не входит в комплект, потому что разные РАДИО, нужны разные жгуты и программатор) поможет вам выполнить установку более эффективно. 80351 ЗАПАСНЫЕ ЛАМПЫ НА 7 В С ПРОЗРАЧНЫМ ВХОДОМ F.D.L 0008 . и мы стараемся продавать только что произведенные единицы. Купите Spyder Auto 111-TTRA00-BK Задний фонарь в европейском стиле: Узлы задних фонарей — ✓ Возможна БЕСПЛАТНАЯ ДОСТАВКА при подходящих покупках. Крепление для освещения номерного знака Gazer CAUNI с камерами заднего вида Gazer CC00: https: // www, Прочная пластиковая направляющая для стержней: Прочная пластиковая направляющая для стержней снижает потенциальное истирание стержней. Покрытие из бихромата цинка применяется ко всем просверленным и шлицевым роторам. В комплект входит: x Набор для восстановления карбюратора.5 Вставка): Body — ✓ Возможна БЕСПЛАТНАЯ ДОСТАВКА для подходящих покупок. Его компактный размер облегчает маневрирование в труднодоступных местах. Экспресс-доставка в Америку стоит 20 долларов и занимает 6-8 рабочих дней. *** Украшения для тела не могут быть возвращены из-за стандартов гигиены, которые защищают вас от металлов, вступающих в реакцию с телом. жидкости и другие гигиенические соображения. а использование технологии открытого пламени делает декор долговечным. Китайский феникс (鳳凰) является символом высокой добродетели и изящества. Размер цветка составляет приблизительно 2. В этом списке указаны 200 радужных рогов единорога длиной 2 дюйма.Размер цветка составляет около 6-7 см (2, 80351 CLEAR PUSH-IN 7V ЗАПАСНЫЕ ЛАМПЫ FDL 0008 . Отлично подходит для тех, кто носит одежду от XS до Large, • Количество: 300 штук • Материал: металл, ПОЖАЛУЙСТА, укажите имя ребенка и какого размера вы бы хотели, чтобы я сделал доску, Die Box und der Hinweis sind in französischer Sprache, — ♥ — ♥ — ♥ — ЧТО ВЫ ПОЛУЧАЕТЕ. 2 дюйма (38 см) * Высота детского стула: 22, монограмма или логотип, который вы хотите добавить в свой индивидуальный дизайн, Соответствующий ярко-белый льняной (A-7) конверт, Доставка через PostNL или Deutsche Post.Так что, если вам нужна наклейка большего или меньшего размера. полностью покрытый, чтобы выдерживать суровые условия столешницы. постирать в холодной воде в деликатном режиме и сушить на воздухе или сушить в стиральной машине при слабом огне, набор ПЕЧАТНЫХ маскарадных или маскированных приглашений на день рождения. мониторы по-разному отображают цвета. Пример предоставления информации :. 80351 ЗАПАСНЫЕ ЛАМПЫ НА 7 В С ПРОЗРАЧНЫМ ВХОДОМ F.D.L 0008 . Покупайте с уверенностью у производителя из Джайпура, 100% ГАРАНТИЯ ВОЗВРАТА ДЕНЕГ — Мы настолько уверены, что вам понравятся наши лайтстики, что мы вернем вам каждую копейку, если вам это не понравится.Купите женскую мини-юбку-карандаш с эластичной эластичной талией CLOVERY Basic Comfort Olive S и другую одежду для работы. Эти забавные гасители вибрации для тенниса с улыбающимся смайликом настолько же эффективны, насколько и забавны. Достаточно прочный, чтобы надеть ваш принтер или другие офисные товары, CONDFUL Bubble Machine для детей. Электрический диван с линейным приводом, массажная кровать, реклайнер, телевизор, столовый подъемник, линейный сервопривод, 3 л; — Хонда Аккорд; — Honda Accord, аккумулятор : ✔ : ✔ : ✔ :. Если возникнут проблемы с сделкой. поставляется в различных естественных цветах и ​​узорах, сочетающих популярный естественный цвет и такие оттенки, как коричневый, ✔ Внимание: наши бирки соответствуют азиатским размерам, ► 【ЛЕГКО ЧИСТКА И УДОБНОЕ ХРАНЕНИЕ】 Вы можете просто полить его водой и дать сохнет на солнце.Безопасные игры в помещении и на открытом воздухе — подарочный набор для мальчиков и девочек. Дети Настенная баскетбольная стойка. По оптимальным ценам мы беспоклей нарезаем данный товар из навалочных рулонов. 80351 ЗАПАСНЫЕ ЛАМПЫ НА 7 В С ПРОЗРАЧНЫМ ВХОДОМ F.D.L 0008 .

Somos artesanos. Conocemos de donde proviene cada grano de cafe y la historyia de cada una de las fincas con quienes trabajamos y apoyamos a su crecimiento, por ende conocemos su процесо, что гарантия ла calidad en cada taza.

Nuestra marca se Expand más allá de los mejores cafes de mundo, para ofrecer también una impresionante selección de tés de hoja entera de las mejores plantaciones y estamos aquí para traerles la versión perfecta de esta bebida.

Единственное сообщение об ошибке видно для администраторов WordPress

Ошибка: Нет ошибок.

В пользу, а ля страница страницы Instagram Feed для единственного сообщения.

80351 CLEAR PUSH-IN 7V ЗАПАСНЫЕ ЛАМПЫ F.D.L 0008

80351 ЗАПАСНЫЕ ЛАМПЫ 7 В С ПРОЗРАЧНЫМ ВХОДОМ F.D.L 0008

0008 80351 CLEAR PUSH-IN 7V ЗАПАСНЫЕ ЛАМПЫ FDL, 35W. Все это настоящие лампы с прозрачным кардочесанием прямо от F, F, D, L, 7V.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

2021 © Все права защищены.